Comparative <i>in vitro</i> activity of various antibiotic against planktonic and biofilm and the gene expression profile in <i>Pseudomonas aeruginosa</i>

Mohammad Abu-Sini; Mohammad A. Al-Kafaween; Rania M. Al-Groom; Abu Bakar Mohd Hilmi; Mohammad Abu-Sini; Mohammad A. Al-Kafaween; Rania M. Al-Groom; Abu Bakar Mohd Hilmi

doi:10.3934/microbiol.2023017

AIMS Microbiology

2023, Volume 9, Issue 2: 313-331. doi: 10.3934/microbiol.2023017

Previous Article Next Article

Research article

Comparative in vitro activity of various antibiotic against planktonic and biofilm and the gene expression profile in Pseudomonas aeruginosa

1.
Department of Pharmacy, Faculty of Pharmacy, Al-Zaytoonah University of Jordan, Amman, Jordan
2.
Department of Medical Laboratory Science, Faculty of Allied Medical Sciences, Zarqa University, Zarqa, Jordan
3.
Department of Allied Medical Sciences, Zarqa University College, Balqa Applied University, Al-Salt, Jordan
4.
Department of Biomedicine, Faculty of Health Sciences, Universiti Sultan Zainal Abidin, Terengganu, Malaysia

Received: 08 December 2022 Revised: 10 March 2023 Accepted: 13 March 2023 Published: 30 March 2023

P. aeruginosa is an opportunistic pathogen that is commonly found in nosocomial infections. The purpose of this study was to investigate the effects of seven antibiotics on P. aeruginosa planktonic growth, biofilm formation, and the expression of virulence factors. These antibiotics included Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery), and Clindamycin (CLI). Antibiotic susceptibility testing, Minimum Bactericidal Concentration (MBC), Minimum Inhibitory Concentration (MIC), growth curve, time-kill curve, biofilm inhibition and reduction assay, and RT-qPCR were used to assess the effects of these antibiotics on P. aeruginosa planktonic and biofilm. The clear zones of inhibition against P. aeruginosa for the CP, AMK, VAN, TET, GEN, Ery, and CLI were 26 mm, 20 mm, 21 mm, 22 mm, 20 mm, 25 mm and 23 mm, respectively. The MIC values for CP, AMK, VAN, TET, GEN, Ery and CLI against P. aeruginosa ranged from 0.25 to 1 µg/mL while the MBC values ranged from 1 and 0.5 to 2 µg/mL respectively. The growth, total viable counts (TVCs), bacterial adhesion and biofilm formation of P. aeruginosa were reduced after exposure to all the tested antibiotics in a dose-dependent manner. The RT-qPCR analysis showed that all the tested antibiotics share a similar overall pattern of gene expression, with a trend toward reduced expression of the virulence genes of interest (lasR, lasI, fleN, fleQ and fleR, oprB and oprC) in P. aeruginosa. The results indicate that all of the tested antibiotics possess antimicrobial and anti-biofilm activities, and that they may be multiple inhibitors and moderators of P. aeruginosa virulence via a variety of molecular targets. This deduction requires to be investigated in vivo.

Keywords:

Citation: Mohammad Abu-Sini, Mohammad A. Al-Kafaween, Rania M. Al-Groom, Abu Bakar Mohd Hilmi. Comparative in vitro activity of various antibiotic against planktonic and biofilm and the gene expression profile in Pseudomonas aeruginosa[J]. AIMS Microbiology, 2023, 9(2): 313-331. doi: 10.3934/microbiol.2023017

Related Papers:

[1]	Rana Abdel Fattah Abdel Fattah, Fatma El zaharaa Youssef Fathy, Tahany Abdel Hamed Mohamed, Marwa Shabban Elsayed . Effect of chitosan nanoparticles on quorum sensing-controlled virulence factors and expression of LasI and RhlI genes among Pseudomonas aeruginosa clinical isolates. AIMS Microbiology, 2021, 7(4): 415-430. doi: 10.3934/microbiol.2021025
[2]	Ogueri Nwaiwu, Chiugo Claret Aduba . An in silico analysis of acquired antimicrobial resistance genes in Aeromonas plasmids. AIMS Microbiology, 2020, 6(1): 75-91. doi: 10.3934/microbiol.2020005
[3]	Kholoud Baraka, Rania Abozahra, Eman Khalaf, Mahmoud Elsayed Bennaya, Sarah M. Abdelhamid . Repurposing of paroxetine and fluoxetine for their antibacterial effects against clinical Pseudomonas aeruginosa isolates in Egypt. AIMS Microbiology, 2025, 11(1): 126-149. doi: 10.3934/microbiol.2025007
[4]	Débora Luíza Albano Fulgêncio, Rosiane Andrade da Costa, Fernanda Guilhelmelli, Calliandra Maria de Souza Silva, Daniel Barros Ortega, Thiago Fellipe de Araujo, Philippe Spezia Silva, Ildinete Silva-Pereira, Patrícia Albuquerque, Cristine Chaves Barreto . In vitro antifungal activity of pelgipeptins against human pathogenic fungi and Candida albicans biofilms. AIMS Microbiology, 2021, 7(1): 28-39. doi: 10.3934/microbiol.2021003
[5]	Saboura Haghighi, Hamid Reza Goli . High prevalence of bla_VEB, bla_GES and bla_PER genes in beta-lactam resistant clinical isolates of Pseudomonas aeruginosa. AIMS Microbiology, 2022, 8(2): 153-166. doi: 10.3934/microbiol.2022013
[6]	Oluwafolajimi Adesanya, Tolulope Oduselu, Oluwawapelumi Akin-Ajani, Olubusuyi M. Adewumi, Olusegun G. Ademowo . An exegesis of bacteriophage therapy: An emerging player in the fight against anti-microbial resistance. AIMS Microbiology, 2020, 6(3): 204-230. doi: 10.3934/microbiol.2020014
[7]	Amira Saied M Abdelhady, Nebal Medhat Darwish, Safaa M. Abdel-Rahman, Nagwa M Abo El Magd . The combined antimicrobial activity of citrus honey and fosfomycin on multidrug resistant Pseudomonas aeruginosa isolates. AIMS Microbiology, 2020, 6(2): 162-175. doi: 10.3934/microbiol.2020011
[8]	Ruba Mirghani, Tania Saba, Hebba Khaliq, Jennifer Mitchell, Lan Do, Liz Chambi, Kelly Diaz, Taylor Kennedy, Katia Alkassab, Thuhue Huynh, Mohamed Elmi, Jennifer Martinez, Suad Sawan, Girdhari Rijal . Biofilms: Formation, drug resistance and alternatives to conventional approaches. AIMS Microbiology, 2022, 8(3): 239-277. doi: 10.3934/microbiol.2022019
[9]	Alaa Fathalla, Amal Abd el-mageed . Salt tolerance enhancement Of wheat (Triticum Asativium L) genotypes by selected plant growth promoting bacteria. AIMS Microbiology, 2020, 6(3): 250-271. doi: 10.3934/microbiol.2020016
[10]	Rochelle Keet, Diane Rip . Listeria monocytogenes isolates from Western Cape, South Africa exhibit resistance to multiple antibiotics and contradicts certain global resistance patterns. AIMS Microbiology, 2021, 7(1): 40-58. doi: 10.3934/microbiol.2021004

Abstract

1. Introduction

P. aeruginosa is an opportunistic pathogen that may persist in a variety of environments, including hospitals. It is one of the most prevalent pathogens identified from nosocomial infections [1],[2]. The potential of P. aeruginosa to colonize medical equipment and human tissues while developing in resistant communities known as biofilms is a worldwide public health problem [3],[4]. In such an environmental niche, the bacterial communities are regulated by various biological processes and use advanced genotypic events to promote different molecular mechanisms and phenotypes that are necessary for survival in the new environment during pathogenesis and antibiotic treatment [5]. Thus, a biofilm is defined as a population of bacteria enclosed inside a self-secreted polymeric extracellular material matrix that is irrevocably adhered to a surface and difficult to remove with a gentle rinsing [6],[7].

Biofilm matrix formation and bacterial growth are influenced by variables such as nutrition availability and hydrodynamic circumstances. Cooperative interactions between species result in a variety of biofilm growth phases, structures, and functions [8],[9]. Because biofilms are polymicrobial, there is intense competition for resources and space [10]. The cohabitation of many bacteria on a surface increases cooperative behaviors such as metabolic cooperation, horizontal gene transfer, and other synergies, resulting in an improved ability of microorganisms to survive and fight antimicrobial chemicals [11],[12]. Resistance to antibiotics is approximately 1000 fold more in attached bacteria than planktonic cells because of an increase in mutation rates, upregulation of efflux pumps, decrease in metabolic activity, and other physical reasons [13]. The resistance mechanism is unique to biofilm-encapsulated bacteria as the biofilm phenotype provides a protective advantage [13],[14]. Bacteria alter gene expression during biofilm development adaption, encouraging phenotypically different behavior compared to planktonic counterparts.

Bacterial communication via the quorum sensing (QS) network is essential during biofilm formation, namely in controlling the genes involved in biofilm growth [15],[16]. According to the National Institutes of Health (NIH), bacterial biofilms are implicated with 65% of microbial diseases and more than 80% of chronic infections [17],[18]. The objective of this study was to (a) determine the antimicrobial activity of CP, AMK, VAN, TET, GEN, Ery against P. aeruginosa planktonic and biofilm stages and (b) estimate the impacts of these antibiotics on the expression of virulence genes in P. aeruginosa

2. Materials and methods

2.1. Bacterial strains and culture conditions

A reference strain of Pseudomonas aeruginosa (ATCC 9027) was purchased from the American Type Culture Collection (ATCC). The strain was streaked on Luria-Bertani (LB) agar and incubated for 24 hrs at 37 °C. After incubation, the strain was inoculated into sterile LB broth and incubated at 37 °C for 12 hrs. The bacterial suspension was then adjusted to be 0.5 McFarland. Then, the strain was stored in Luria-Bertani (LB) broth containing 20% (v/v) glycerol at −80 °C [19]–[21].

2.2. Antibiotic susceptibility testing

The antibiotic-susceptibility testing was performed using Muller Hinton agar (MHA) by the modified Kirby-Bauer disc diffusion method following Clinical and Laboratory Standard guidelines (CLSI) [22],[23]. The antibiotics tested in this study were ciprofloxacin (5 µg), gentamicin (10 µg), tetracycline (30 µg), amikacin (30 µg), clindamycin (10 µg), erythromycin (15 µg), and vancomycin (30 µg). A suspension of P. aeruginosa adjusted to 0.5 McFarland standards and streaked on Mueller Hinton Agar (MHA) plates using sterile swabs and antibiotic discs were placed on top. The plates were incubated for 24 hrs at 37 °C. Distilled water was used as a negative control. The diameter of the zone of inhibition for each antibiotic was measured by digital venire caliper. The experiment was carried out in triplicate [20],[22],[23].

2.3. MIC and MBC determination

Different concentrations (8, 4, 2, 1, 0.5, 0.25 and 0.125 µg/mL) for CP, AMK, VAN, TET, GEN, Ery and CLI were prepared. A suspension of P. aeruginosa was adjusted to be 0.5 McFarland standards as described previously. Briefly, 100 µL of each antibiotic dispensed with 100 µL of suspension into microtiter plate. Bacteria with antibiotic was used as positive control and antibiotic with broth was served as negative control. Then, the plates were incubated for 24 hrs at 37 °C. After incubation time was done, microplate reader was used to measure the optical density (OD) at 540 nm wavelength. The MIC value was set as the minimum concentration of the antimicrobial necessary to prevent bacterial growth after 24 hrs of incubation at 37 °C. For MBC determination, samples in the wells without turbidity were spread onto LB agar and incubated at 37 °C for 24 hrs. The minimum concentration that resulted in no P. aeruginosa growth on the plate was defined as MBC. The experiment was performed in triplicate [21],[24]–[27].

2.4. Growth curve determination

Briefly, P. aeruginosa suspension treated with CP, GEN, TET, AMK, CLI, Ery and VAN (0, 1/4 × MIC, 1/2 × MIC and 1 × MIC) and incubated statically at 37 °C in a 96-well plate for 24 hrs. The optical density at 540 nm (OD₅₄₀ nm) of each sample was measured at 2-h intervals using a microplate reader. The concentrations that exerted no significant effects on P. aeruginosa growth were considered as the sub-inhibitory concentrations (SICs) of CP, GEN, TET, AMK, CLI, Ery and VAN [20],[23],[28],[29].

2.5. Time-kill curve

The time-kill assay was performed as described by Shi et al., (2016) with few modifications. Microcentrifuge tubes containing control, MIC, and MBC values of CP, AMK, VAN, TET, GEN, Ery and CLI were incubated with P. aeruginosa suspension (1 x 10⁶ cfu/mL). Aliquots from above mixture were taken at a different time interval (0, 3, 6, 9, 12, 15, and 18, 21, 24 h), serially diluted and plated on the LB agar plate. Following 24 hrs of incubation, colony counting was performed by using colony counter. Time-kill curve was plotted by assessing the log₁₀ CFU (colony forming units) versus time [20],[21],[23],[28],[30].

2.6. Biofilm inhibition-crystal violet assay

P. aeruginosa were grown for 48 hrs in LB broth. A mixture of bacterial broth and 8, 4, 2, 1, 0.5, 0.25 and 0.125 µg/mL concentration of CP, AMK, VAN, TET, GEN, Ery and CLI was added to the 96-well plates. Incubation was done overnight at 37 °C. After 12 hrs incubation, culture supernatant was removed and washed with PBS to remove unbound bacteria. The bound bacteria were fixed with methanol for 10 minutes and air dried. Bound bacteria were stained using crystal violet (0.1% w/v) for 3 minutes, and unbound dye was washed away with distilled water. The plate was air-dried, and bound dye was dissolved in 95% (v/v) ethanol. The optical density (OD) was read at 540 nm using a microplate reader. The percentage of biofilm inhibition was calculated by following formulas as mentioned below. The experiment was repeated in triplicate [20],[21],[23],[31],[32].

$Percentage inhibition (%) = \frac{OD (positive control value) - OD (sample value) \times 100 %}{OD (positive control value)}$ (1)

2.7. Biofilm reduction-crystal violet assay

Briefly, overnight grown P. aeruginosa having a concentration of 0.5 McFarland standards was inoculated in LB broth in each well and 200 µL of sterile distilled water was added into wells to reduce the water loss. The plate was then kept at 37 °C for 72 hrs to allow the bacteria to grow and form the biofilms the well's bottom surface. Each well was later replaced with 8, 4, 2, 1, 0.5, 0.25 and 0.125 µg/mL concentrations of CP, AMK, VAN, TET, GEN, Ery and CLI in culture medium and culture medium alone (control). The incubation was continued for another 24 hrs under the same condition. After 24 hrs, the supernatant was discarded, and wells were rinsed with PBS. Fixation was done with ethanol as described previously. The percentage of biofilm reduction was calculated by following formulas as mentioned below [21],[24],[28],[33]–[35].

$Percentage reduction (%) = \frac{OD (positive control value) - OD (sample value) \times 100 %}{OD (positive control value)}$ (2)

2.8. Extraction of RNA for RT-qPCR

P. aeruginosa was grown in duplicate in 5 mL LB broth with MIC and MBC of CP, AMK, VAN, TET, GEN, Ery and CLI for 24 hrs at 37 °C. After incubation, the samples were re-suspended in 500 mL PBS and vortexed for 2 minutes to break up cell aggregates. Then, the RNA was extracted using the SV total RNA extraction kit (Promega, UK). The bacterial total RNA integrity was checked by NanoDrop, and each RNA sample was adjusted to give a final concentration of 100 ng/µL. The primers were used for P. aeruginosa as shown in Table 1. Reverse RNA transcription was performed with Oligo (dT)₁₅ primers and Random Primers. Total RNA samples were converted to cDNA using a high capacity RNA to cDNA conversion kit (Promega, UK) and quantitative PCR expression analysis as following the manufacturer's instructions (Promega, UK). Densitometry was performed using the Applied Biosystems StepOne Software v2.3 to determine the level of relative gene expression in P. aeruginosa samples. A modified 2^−ΔΔ Ct method was used. All reactions were carried out in triplicate, and the genes' expressions were analyzed with reference to the housekeeping gene expression [21],[36]–[45].

Table 1. Primers for RT-qPCR of P. aeruginosa.

Gene name	Amplicon Size (bp)	Annealing temp (°C)	Direction	Primer sequence (5′→ 3′)
oprB	140	54	Forward	TGACGACGACAAGACAGGAC
			Reverse	GGTCGTTGGAAAGGTTCTTG
oprC	105	55	Forward	GCCTGAACATCCTCACCAAC
			Reverse	CGGTGAGCTTGTCGTAGGTT
fleN	137	56	Forward	GAGCCGTATACGAGGCATTC
			Reverse	GTGTTGGACCAGTCGTTCG
fleQ	134	54	Forward	AAGGACTACCTGGCCAACCT
			Reverse	CCGTACTTGCGCATCTTCTC
fleR	109	55	Forward	ACAGCCGCAAGATGAACCT
			Reverse	TGGATGGCGTTGTCGAGTT
lasR	129	54	Forward	CGGTTTTCTTGAGCTGGAAC
			Reverse	TCGTAGTCCTGGCTGTCCTT
lasI	129	54	Forward	ATGATCGTACAAATTGGTCGGC
			Reverse	GTCATGAAACCGCCAGTCG
rpoD (Reference gene)	146	53	Forward	GCGACGGTATTCGAACTTGT
			Reverse	CGAAGAAGGAAATGGTCGAG

| Show Table

DownLoad: CSV

2.9. Statistical analysis

Data were presented as mean ± standard deviation. To compare the treatment and control groups, an independent student t-test from SPSS version 20 was employed. The significance level was set at P < 0.05.

3. Results

3.1. Antibiotic susceptibility testing

As shown in Table 2, the antibiotic susceptibility of CP, AMK, VAN, TET, GEN, Ery and CLI were showed varying degrees of inhibitory activity against P. aeruginosa. The inhibition zone of CP, AMK, VAN, TET, GEN, Ery and CLI against the P. aeruginosa were 26 mm, 20 mm, 21 mm, 22 mm, 20 mm, 25 mm and 23 mm respectively. The most antibiotic effective on P. aeruginosa was Ciprofloxacin (CP).

Table 2. Zones of inhibition dimeter (mm) of the tested antibiotics against P. aeruginosa.

Antibiotics	1st	2nd	3rd	Main value
Ciprofloxacin (CP)	26 mm ± 1.1	26 mm ± 1.0	26 mm ± 1.2	26 mm ± 1.1
Amikacin (AMK)	20 mm ± 0.3	20 mm ± 0.3	20 mm ± 0.3	20 mm ± 0.3
Vancomycin (VAN)	21 mm ± 0.6	21 mm ± 0.6	21 mm ± 0.5	21 mm ± 0.6
Tetracycline (TET)	22 mm ± 0.7	22 mm ± 0.8	22 mm ± 0.7	22 mm ± 0.7
Gentamicin (GEN)	20 mm ± 0.6	20 mm ± 0.5	20 mm ± 0.6	20 mm ± 0.6
Erythromycin (Ery)	25mm ± 0.9	25 mm ± 0.9	25 mm ± 0.8	25 mm ± 0.9
Clindamycin (CLI)	23 mm ± 0.8	23 mm ± 0.8	23 mm ± 0.8	23 mm ± 0.8

Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI), Mean ±standard deviation (SD), n =3

| Show Table

DownLoad: CSV

3.2. MIC and MBC determination

The antimicrobial activity of CP, AMK, VAN, TET, GEN, Ery and CLI against P. aeruginosa were performed using the standard broth dilution method. The MIC value of CP and AMK were 0.25 µg/mL, and 0.5 µg/mL for VAN and TET, and 1.0 µg/mL for GEN, Ery and CLI against P. aeruginosa. The MBC value of CP and AMK was 0.5 µg/mL, and 1.0 µg/mL for VAN and TET, and 2.0 µg/mL for GEN, Ery and CLI against P. aeruginosa (Table 3).

Table 3. MIC and MBC values of antibiotics against P. aeruginosa.

MBC (µg/mL)	MIC (µg/mL)	Antibiotics
0.5	0.25	CP
0.5	0.25	AMK
1.0	0.5	VAN
1.0	0.5	TET
2.0	1.0	GEN
2.0	1.0	Ery
2.0	1.0	CLI

Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI). Mean ± standard deviation (SD), n = 3

| Show Table

DownLoad: CSV

3.3. Growth curve determination

Effects of CP, AMK, VAN, TET, GEN, Ery and CLI (0, 1/4 × MIC, 1/2 × MIC and 1 × MIC) on the growth of P. aeruginosa were evaluated by growth curve assay. As shown in Figure 1, after P. aeruginosa exposure to all the antibiotics at the concentration of 1/4 × MIC, 1/2 × MIC and 1 × MIC, the optical density (OD) value of untreated samples was increased. P. aeruginosa growth curves in the presence of all the antibiotics (1/4 × MIC) were similar to that of the control, indicating that all the antibiotics (1/4 × MIC) showed no significant effect on P. aeruginosa growth. In the presence of 1/2 × MIC and 1 × MIC of CP, AMK, VAN, TET, GEN, Ery and CLI, the OD value was almost unchanged in 6 hrs and decreased after 6 hrs, suggesting that all the antibiotics at 1/2 × MIC and 1 × MIC could inhibit the growth of P. aeruginosa. As a result, these concentrations were considered as SICs of antibiotics against P. aeruginosa.

Figure 1. Growth curves of P. aeruginosa in the presence of antibiotics at the concentrations of 0 (control), 1/4 × MIC, 1/2 × MIC and 1 × MIC for 24 hrs. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI). Mean ±standard deviation (SD), n = 3.

DownLoad: Full-Size Img PowerPoint

3.4. Time-kill curve

Time-kill test the time-kill assay was used to assess the antibacterial activity of CP, AMK, VAN, TET, GEN, Ery, and CLI against P. aeruginosa. This test was carried out after the bacteria were exposed to MIC and MBC concentrations of all antibiotics for different time intervals. At the MIC concentration, bacterial growth was inhibited in a time-dependent manner, but at the MBC concentration, 99% inhibition was achieved within 24 hrs. As shown in Figure 2, the starting concentration of P. aeruginosa in all samples was 5.1-log cfu/mL. Without antibiotics, the number of bacterial cells grew to 8.9-log cfu/mL after 24 hrs. However, treatment with CP, AMK, VAN, TET, GEN, Ery, and CLI (MIC) resulted in a significant decrease in the growth of P. aeruginosa. After 24 hrs of treatment with CP, AMK, VAN, TET, GEN, Ery, and CLI (MIC), the bacterial count was decreased to 2.3-log cfu/mL. In addition, after exposure to CP, AMK, VAN, TET, GEN, Ery and CLI at MBC, the bacterial number decreased to 2.0-log cfu/mL.

Figure 2. Time-kill curves of antibiotics against P. aeruginosa. Samples were treated with antibiotics at the concentrations of 0 (control), 1 × MIC and 2 × MIC for 24 hrs. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI), Mean ±standard deviation (SD), n = 3.

DownLoad: Full-Size Img PowerPoint

3.5. Biofilm inhibition-crystal violet assay

The biofilm reduction assay showed that 8, 4, 2, 1 and 0.5 µg/mL concentration of CP, AMK, VAN, TET, GEN, Ery, and CLI significantly reduced the number of attached P. aeruginosa cells, up to 60% (P < 0.05) relative to the control group. Furthermore, P. aeruginosa biofilm development was not significantly reduced following treatment with 0.5 and 0.25 µg/mL of CP, AMK, VAN, TET, GEN, Ery, and CLI. The lowest dose of CP, AMK, VAN, TET, GEN, Ery, and CLI that inhibited P. aeruginosa biofilm was determined to be 0.125 µg/mL (Figure 3).

Figure 3. Inhibition of biofilm formation in P. aeruginosa in the presence of antibiotics. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI), Mean ± standard deviation (SD), n = 3. Asterisks; *P < 0.05 indicate statistically significant difference between treated and control samples.

DownLoad: Full-Size Img PowerPoint

3.6. Biofilm reduction-crystal violet assay

As shown in Figure 4, at 8, 4, 2, 1 and 0.5 µg/mL concentration of CP, AMK, VAN, TET, GEN, Ery, and CLI significantly reduced (P < 0.05) the adhesion of P. aeruginosa biofilm compared to the control. However, 0.25 and 0.125 µg/mL concentration of CP, AMK, VAN, TET, GEN, Ery, and CLI did not show any significant effect.

Figure 4. Reduction of P. aeruginosa biofilm after exposure to antibiotics. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI), Mean ± standard deviation (SD), n = 3. Asterisks; *P < 0.05 indicate statistically significant difference between treated and control samples.

DownLoad: Full-Size Img PowerPoint

3.7. Gene expression profile

RT-qPCR was used to study the influence of antibiotics (at MIC and MBC) on virulence factor expression levels of the microcolony formation, motility, outer membrane protein and biofilm involved genes in P. aeruginosa. All the tested antibiotics (CP, AMK, VAN, TET, GEN, Ery, and CLI) caused a reduction in the gene expression of all virulence factors in dose-dependent manner. The antibiotics significantly reduced oprB, oprC, fleN, fleQ, fleR, lasR and lasI expression at MICs (P < 0.05) and MBCs (P < 0.01) concentration (Figures 5 and 6).

3.7.1. Genes involved in biofilm formation were suppressed after exposure to antibiotics

The inability of P. aeruginosa to form biofilm in respond to MICs and MBCs TH treatment was demonstrated by two biofilm-forming genes, lasR and lasI. The lasR and lasI were significantly (P < 0.05) downregulated in P. aeruginosa after being treated with MICs (P < 0.05) and MBCs (P < 0.01) concentration of all the tested antibiotics (Figures 5 and 6).

3.7.2. Flagella-associated genes were suppressed by antibiotics

Three investigated flagella genes: fleN, fleQ and fleR of P. aeruginosa demonstrated the significant reduction of gene expressions in response to exposure to MICs (P < 0.05) and MBCs (P < 0.01) concentration of all the tested antibiotics (Figures 5 and 6).

3.7.3. Genes associated with outer-membrane protein were suppressed following treatment with antibiotics

Two investigated genes; oprB and oprC associated with the outer membrane protein (cell wall stability, diffusion and virulence) of P. aeruginosa showed the significant reduction (P < 0.05) of gene expressions following treatment with MICs (P < 0.05) and MBCs (P < 0.01) concentration of all the tested antibiotics (Figures 5 and 6).

Figure 5. The level of gene expression in P. aeruginosa in the absence and presence of MIC of all the tested antibiotics, as assessed by RT-qPCR. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI). Data is mean ± SD of these independent experiments. Significant difference indicated as *P < 0.05, **P < 0.01 between control versus treated samples.

DownLoad: Full-Size Img PowerPoint

Figure 6. The level of gene expression in P. aeruginosa in the absence and presence of MBC of all the tested antibiotics, as assessed by RT-qPCR. Ciprofloxacin (CP), Amikacin (AMK), Vancomycin (VAN), Tetracycline (TET), Gentamicin (GEN), Erythromycin (Ery) and Clindamycin (CLI). Data is mean ± SD of three independent experiments. Significant difference indicated as *P < 0.05, **P < 0.01 between control versus treated samples.

DownLoad: Full-Size Img PowerPoint

4. Discussion

P. aeruginosa is an important human opportunistic pathogen that causes acute and persistent infections, particularly in immunocompromised patients. Overuse of antibiotics in recent decades has resulted in the evolution of resistant forms of these bacteria [46]. Biofilm development is one of these bacteria's strategies for reducing the effect of antibiotic treatment. P. aeruginosa biofilm is a structure made up of several biomolecules that develop as they come together. Bacterial attachment factors, extracellular polysaccharides (EPS), and extracellular DNA (eDNA) all play a role in the creation of this structure [47]. Two-component regulatory systems and bacterial quorum sensing regulate the expression of key genes during the secretion and development of biofilm components. Failure in these processes results in a stop in biofilm formation or a faulty structure [48].

The MIC and MBC values indicated that CP, AMK, VAN, TET, GEN, Ery, and CLI demonstrated effective antimicrobial activity against P. aeruginosa. In the present study, CP, AMK, VAN, TET, GEN, Ery, and CLI were demonstrated to show antimicrobial activity against P. aeruginosa with the MIC 0.25, 0.25, 0.5, 0.5, 1.0, 1.0 and 1.0 µg/mL respectively and with the MBC 0.5, 0.5, 1.0, 1.0, 2.0, 2.0 and 2.0 µg/mL respectively. Study by [49] showed that the MIC and MBC values of Ciprofloxacin were 0.5 µg/mL and 8 µg/mL against P. aeruginosa [49]. Another study explored that the MIC value of Ciprofloxacin and Azithromycin was between 2 to >64 µg/mL and the MIC value of Erythromycin was between 8 to >64 µg and the MBC value was between 2 to >64 µg/mL against P. aeruginosa [50].

Growth curves with (1/2 MIC and 1 MIC) of all tested antibiotics resulted in a lower growth rate and total cell number of P. aeruginosa during a 24 hrs, compared to cells grown without antibiotics. The time-kill assay showed that CP, AMK, VAN, TET, GEN, Ery, and CLI have bactericidal effects against the strain of P. aeruginosa at MBC concentration. Bacterial inhibition increases with antibiotic concentration and incubation time. A biofilm is an aggregation of one or more species of microorganisms adhered to a surface, as compared to planktonic bacteria, which exist as individual organisms [20],[51]. Biofilm-forming bacteria are reported to be 100–1000 times more resistant to antibiotics than planktonic bacteria [13],[14]. In this study, biofilm inhibition and reduction-crystal violet assay suggested that all the tested antibiotics at 8, 4, 2, 1 and 0.5 µg/mL concentrations were significantly able to decrease P. aeruginosa biofilm formation. Studies evaluating the efficiency of antibiotic mono or combination treatment against biofilm infections are important and valued by the medical community. However, only a few studies have performed such research in models mimicking real biofilm infections. Aminoglycoside in combination with b-lactam antibiotics is often used intravenously in hospitals as the major treatments against P. aeruginosa infection. Furthermore, biofilm bacteria, but not adherent bacteria, were significantly more resistant to two- or three antibiotic combination treatments than the planktonic bacteria [52], [53].

In general, concentration-dependent killing was demonstrated in our study. It was possible to remove more than 50% of the bacteria in mature in vitro biofilms after treated with 8, 4, 2, and 1 µg/mL concentration of antibiotic. Antibiotics were able to reduce the number of live bacteria at 8, 4, 2, 1 and 0.5 µg/mL concentrations suggesting that it has bactericidal. Effect of antibiotics (CP, AMK, VAN, TET, GEN, Ery, and CLI) on relative expression of genes (oprB, oprC, fleN, fleQ, fleR, lasR and lasI) associated with biofilm formation, motility, and outer membrane protein of P. aeruginosa was further investigated by RT-qPCR, and the result showed that transcriptional levels of seven related genes were significantly downregulated by antibiotics at MIC and MBC. These findings indicated that each antibiotic had the potential to be an anti-biofilm agent. At present, studies concerning anti-biofilm effect on P. aeruginosa by antibiotics are relatively limited, and therefore, more related investigations are required. In summary, antibiotics have good antibacterial and anti-biofilm activity against P. aeruginosa. antibiotics could inactivate P. aeruginosa cells. Furthermore, antibiotics at MIC and MBC could depress biofilm formation by P. aeruginosa and downregulate the transcriptional levels of related genes. This study indicated that antibiotics is an effective to control the contamination and infection caused by P. aeruginosa. Further studies focused on the anti-biofilm mechanism of antibiotics should be conducted.

5. Conclusion

Susceptibility testing of planktonic bacteria can be an impediment to the effective treatment of chronic caused by biofilm-forming pathogens. The clear zones of inhibition against P. aeruginosa for the CP, AMK, VAN, TET, GEN, Ery, and CLI were 26 mm, 20 mm, 21 mm, 22 mm, 20 mm, 25 mm and 23 mm, respectively. In addition, the MIC values for CP, AMK, VAN, TET, GEN, Ery and CLI against P. aeruginosa ranged from 0.25 to 1 µg/mL while the MBC values ranged from 1 and 0.5 to 2 µg/mL respectively. In this study, there is a minor variation in MIC and MBC between the antibiotics against P. aeruginosa and each antibiotic inhibited P. aeruginosa biofilm. In the current study, RT-qPCR analysis showed that all the tested antibiotics share a similar overall pattern of gene expression, with a trend toward reduced expression of the virulence genes of interest in P. aeruginosa. The findings suggest that these antibiotics may be potential anti-biofilm and anti-virulence agents for the treatment and regulation of P. aeruginosa infections. The current study findings might be validated using a combination of real-time PCR and microarray analysis. It would also be interesting to investigate the genes involved in biofilm formation, quorum sensing, and auto-inducers in P. aeruginosa and to find other gene expression pathways. However, further studies are warranted to study the effect of antibiotics on more virulent strains of P. aeruginosa and study it's in vivo efficacy in suitable animal models.

Acknowledgments

This work was supported by Al-Zaytoonah University of Jordan (Grant Number: 2019-2018/18/09) and Universiti Sultan Zainal Abidin (UniSZA) (UniSZA/2018/DPU/13:R0034-R013). The authors thank all the staff members of the Faculty of Pharmacy at Al-Zaytoonah University of Jordan and the Faculty of Health Sciences at UniSZA for their support and commitment.

Conflict of interest

The authors declare that there is no conflict of interest.

References

[1]	Al-Kafaween MA, Al-Jamal HA, Hilmi AB, et al. (2020) Antibacterial properties of selected Malaysian Tualang honey against Pseudomonas aeruginosa and Streptococcus pyogenes. Iran J Microbiol 12: 565-576. https://doi.org/10.18502/ijm.v12i6.5031
[2]	Streeter K, Katouli M (2016) Pseudomonas aeruginosa: a review of their pathogenesis and prevalence in clinical settings and the environment. Infect Epidemiol Med 2: 25-32. https://doi.org/10.7508/iem.2016.01.008
[3]	Al-kafaween MA, Hilmi ABM, Al-Jamal HAN, et al. (2020) Potential antibacterial activity of yemeni sidr honey against Pseudomonas aeruginosa and Streptococcus pyogenes. Anti Infect Agents 19: 51-65. https://doi.org/10.2174/2211352519666210319100204
[4]	del Mar Cendra M, Torrents E (2021) Pseudomonas aeruginosa biofilms and their partners in crime. Biotechnol Adv 49: 107734. https://doi.org/10.1016/j.biotechadv.2021.107734
[5]	Dufour D, Leung V, Lévesque CM (2010) Bacterial biofilm: structure, function, and antimicrobial resistance. J Endod 22: 2-16. https://doi.org/10.1111/j.1601-1546.2012.00277
[6]	AL-Kafaween MA, Khan RS, Hilmi ABM, et al. (2019) Characterization of biofilm formation by Escherichia coli: An in vitro study. J appl biol biotechnol 7: 17-19. http://dx.doi.org/10.7324/JABB.2019.70304
[7]	Thi MTT, Wibowo D, Rehm BH (2020) Pseudomonas aeruginosa biofilms. Int J Mol Sci 21: 8671.
[8]	Al Kafaween MA, Hilmi ABM, Khan RS, et al. (2019) Effect of Trigona honey on Escherichia coli cell culture growth: In vitro study. J Apither 5: 10-17. http://dx.doi.org/10.5455/Ja.20190407083601
[9]	Rendueles O, Ghigo JM (2015) Mechanisms of competition in biofilm communities. Microbial Biofilms 10: 319-342. https://doi.org/10.1128/9781555817466.ch16
[10]	Bouacha M, Besnaci S, Boudiar I, et al. (2022) Impact of storage on Honey antibacterial and antioxidant activities and their correlation with polyphenolic content. Trop J Nat Prod Res 6: 34-39. https://doi.org/doi. org/10.26538/tjnpr/v6i17
[11]	Tan CH, Lee KWK, Burmølle M, et al. (2017) All together now: experimental multispecies biofilm model systems. Environ Microbiol 19: 42-53. https://doi/10.1111/1462-2920.13594
[12]	Bouacha M, Boudiar I, Akila A, et al. (2022) The antimutagenic effect of multifloral Honey in Salmonella/microsomal assay and its correlation with the total polyphenolic content. J Microbiol Biotechnol Food Sci 11: E5557-E. https://doi.org/10.55251/jmbfs.5557
[13]	Tarawneh O, Alwahsh W, Abul-Futouh H, et al. (2021) Determination of antimicrobial and antibiofilm activity of combined LVX and AMP impregnated in p (HEMA) hydrogel. Appl Sci 11: 8345. https://doi.org/10.3390/app11188345
[14]	Huwaitat R, Coulter SM, Porter SL, et al. (2021) Antibacterial and antibiofilm efficacy of synthetic polymyxin-mimetic lipopeptides. Pept Sci 113: e24188. https://doi.org/10.1002/pep2.24188
[15]	Alkafaween MA, Kafaween H, Al-Groom RM (2022) A comparative study of antibacterial activity of citrus and Jabali Honeys with Manuka Honey. Appl Environ Biotechnol 7: 28-37. https://doi.org/10.26789/AEB.2022.01.004
[16]	Mahto KU, Kumari S, Das S (2022) Unraveling the complex regulatory networks in biofilm formation in bacteria and relevance of biofilms in environmental remediation. Crit Rev Biochem Mol 57: 305-320. https://doi.org/10.1080/10409238.2021.2015747
[17]	Olivares E, Badel-Berchoux S, Provot C, et al. (2020) Clinical impact of antibiotics for the treatment of Pseudomonas aeruginosa biofilm infections. Front Microbiol 10: 2894. https://doi.org/10.3389/fmicb.2019.02894
[18]	Mabrouka B, Ines B, Al-Kafaween MA, et al. (2022) Screening of the antibacterial and antibiofilm effect of multifloral honey against multidrug-resistant Pseudomonas aeruginosa. Acta Microbiol Hell 67: 69-79.
[19]	Al-Kafaween MA, HANA J, Abu Bakar MH (2022) De novo whole genome sequencing data of Pseudomonas aeruginosa ATCC10145, an opportunistic pathogen. Trop J Nat Prod Res 6: 176-9.
[20]	Alkafaween MA, Abu-Sini M, Al-Jamal HAN (2022) Antibiotic susceptibility and differential expression of virulence genes in Staphylococcus aureus. Appl Environ Biotechnol 7: 6-15. https://doi.org/10.26789/AEB.2022.01.002
[21]	Kumbar VM, Peram MR, Kugaji MS, et al. (2021) Effect of curcumin on growth, biofilm formation and virulence factor gene expression of Porphyromonas gingivalis. Odontology 109: 18-28. https://doi.org/10.1007/s10266-020-00514
[22]	Bhandari S, Adhikari S, Karki D, et al. (2022) Antibiotic resistance, biofilm formation and detection of mexA/mexB efflux-pump genes among clinical isolates of Pseudomonas aeruginosa in a Tertiary Care Hospital, Nepal. Front Trop Dis 2: 810863. https://doi.org/10.3389/fitd.2021.810863
[23]	Hassan MM, Harrington NE, Sweeney E, et al. (2020) Predicting antibiotic-associated virulence of pseudomonas aeruginosa using an ex vivo lung biofilm model. Front Microbiol 11: 568510. https://doi.org/10.3389/fmicb.2020.568510
[24]	Rodríguez C, Alonso C, García C, et al. (2021) Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) for twelve antimicrobials (biocides and antibiotics) in eight strains of listeria monocytogenes. Biology 11: 1-16. https://doi.org/10.3390/biology11010046
[25]	Al-Bakri AG, Mahmoud NN (2019) Photothermal-induced antibacterial activity of gold nanorods loaded into polymeric hydrogel against Pseudomonas aeruginosa biofilm. Molecules 24: 1-19. https://doi.org/10.3390/molecules24142661
[26]	Al-kafaween MA, Al-Jamal HAN (2022) A comparative study of antibacterial and antivirulence activities of four selected honeys to Manuka honey. Iran J Microbiol 14: 238-251. https://doi.org/10.18502%2Fijm.v14i2.9193
[27]	Zainol MI, Mohd Yusoff K, Mohd Yusof MY (2013) Antibacterial activity of selected Malaysian honey. BMC 13: 1-10. https://doi.org/10.1186/1472-6882-13-129
[28]	Al-kafaween MA, Abu baker MH, Hamid AJ (2021) The beneficial effects of stingless bee kelulut honey against Pseudomonas aeruginosa and Streptococcus pyogenes planktonic and biofilm. Trop J Nat Prod Res 5: 1788-1796. https://doi.org/10.26538/tjnpr/v5i10.15
[29]	Kim YG, Baltabekova AZ, Zhiyenbay EE, et al. (2017) Recombinant vaccinia virus-coded interferon inhibitor B18R: Expression, refolding and a use in a mammalian expression system with a RNA-vector. PLoS One 12: e0189308. https://doi.org/10.1371/journal.pone.0189308
[30]	Shi C, Zhao X, Yan H, et al. (2016) Effect of tea tree oil on Staphylococcus aureus growth and enterotoxin production. Food Control 62: 257-263. https://doi.org/10.1016/j.foodcont.2015.10.049
[31]	Al-kafaween MA, Mohd Hilmi AB, Jaffar N, et al. (2020) Effects of Trigona honey on the gene expression profile of Pseudomonas aeruginosa ATCC 10145 and Streptococcus pyogenes ATCC 19615. Jordan J Biol Sci 1: 133-138.
[32]	Olivares E, Badel-Berchoux S, Provot C, et al. (2017) Tobramycin and amikacin delay adhesion and microcolony formation in Pseudomonas aeruginosa cystic fibrosis isolates. Front Microbiol 8: 1289. https://doi.org/10.3389/fmicb.2017.01289
[33]	Kaur S, Harjai K, Chhibber S (2012) Methicillin-resistant Staphylococcus aureus phage plaque size enhancement using sublethal concentrations of antibiotics. Appl Environ Microbiol 2012; 78: 8227-8233. https://doi.org/10.1128/AEM.02371-12
[34]	Gomes F, Teixeira P, Cerca N, et al. (2011) Virulence gene expression by Staphylococcus epidermidis biofilm cells exposed to antibiotics. Microb Drug Resist 17: 191-196. https://doi.org/10.1089/mdr.2010.0149
[35]	Resch A, Rosenstein R, Nerz C, et al. (2005) Differential gene expression profiling of Staphylococcus aureus cultivated under biofilm and planktonic conditions. Appl Environ Microbiol 71: 2663-2676. https://doi.org/10.1128/AEM.71.5.2663-2676.2005
[36]	Maddocks SE, Lopez MS, Rowlands RS, et al. (2012) Manuka honey inhibits the development of Streptococcus pyogenes biofilms and causes reduced expression of two fibronectin binding proteins. Microbiology 158: 781-790. https://doi.org/10.1099/mic.0.053959-0
[37]	Roberts AE, Maddocks SE, Cooper RA (2012) Manuka honey is bactericidal against Pseudomonas aeruginosa and results in differential expression of oprF and algD. Microbiology 158: 3005-3013. https://doi.org/10.1099/mic.0.062794-0
[38]	Wasfi R, Elkhatib WF, Khairalla AS (2016) Effects of selected Egyptian honeys on the cellular ultrastructure and the gene expression profile of Escherichia coli. PloS one 11: e0150984. https://doi.org/10.1371/journal.pone.0150984
[39]	Yadav MK, Kwon SK, Cho CG, et al. (2012) Gene expression profile of early in vitro biofilms of Streptococcus pneumoniae. Microbiol Immunol 56: 621-629. https://doi.org/10.1111/j.1348-0421.2012.00483
[40]	Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 25: 402-408. https://doi.org/10.1006/meth.2001.1262
[41]	Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3: 11-18. https://doi.org/10.1038/nprot.2008.73
[42]	Al-kafaween MA, Hilmi AB, Al-Jamal HA, et al. (2021) Effects of selected Malaysian Kelulut Honey on biofilm formation and the gene expression profile of Staphylococcus Aureus, Pseudomonas Aeruginosa and Escherichia Coli. Jordan J Pharm Sci 14: 1-18.
[43]	Al-Kafaween MA, Hilmi AB, Al-Jamal HN, et al. (2020) Pseudomonas aeruginosa and Streptococcus pyogenes exposed to Malaysian trigona honey in vitro demonstrated downregulation of virulence factor. Iran J Biotechnol 18: e2542. https://doi.org/10.30498/ijb.2020.2542
[44]	Jarrar YB, Jarrar Q, Abaalkhail SJ, et al. (2022) Molecular toxicological alterations in the mouse hearts induced by sub-chronic thiazolidinedione drugs administration. Fundam Clin Pharmacol 36: 143-149. https://doi.org/10.1111/fcp.12694
[45]	Jarrar Y, Jarrar Q, Abu-Shalhoob M, et al. (2019) Relative expression of mouse Udp-glucuronosyl transferase 2b1 gene in the livers, kidneys, and hearts: the influence of nonsteroidal anti-inflammatory drug treatment. Curr Drug Metab 20: 918-923. https://doi.org/10.2174/1389200220666191115103310
[46]	Tielen P, Kuhn H, Rosenau F, et al. (2013) Interaction between extracellular lipase LipA and the polysaccharide alginate of Pseudomonas aeruginosa. BMC 13: 1-12. https://doi.org/10.1186/1471-2180-13-159
[47]	Ceylan M, Yang SY, Asmatulu R (2017) Effects of gentamicin-loaded PCL nanofibers on growth of Gram positive and Gram negative bacteria. IJAMBR 5: 40-51.
[48]	Sharifian P, Yaslianifard S, Fallah P, et al. (2020) Investigating the effect of nano-curcumin on the expression of biofilm regulatory genes of Pseudomonas aeruginosa. Infect Drug Resist 13: 1-8.
[49]	Liu Y, Moore JH, Kolling GL, et al. (2020) Minimum bactericidal concentration of ciprofloxacin to Pseudomonas aeruginosa determined rapidly based on pyocyanin secretion. Sens Actuators B Chem 312: 1-12. https://doi.org/10.1016/j.snb.2020.127936
[50]	Chowdhury SA, Naher J, Mamun AA, et al. (2014) Studies on antibiotic sensitivity pattern of Pseudomonas aeruginosa isolated from hospitalized patients. OALib J 1: 1-9. http://dx.doi.org/10.4236/oalib.1100911
[51]	Al-kafaween MA, Hilmi AB (2022) Evaluation of the effect of different growth media and incubation time on the suitability of biofilm formation by Pseudomonas aeruginosa and Streptococcus pyogenes. Appl Environ Biotechnol 6: 19-26. http://doi.org/10.26789/AEB.2021.02.003
[52]	Wu H, Song L, Yam JKH, et al. (2022) Effects of antibiotic treatment and phagocyte infiltration on development of Pseudomonas aeruginosa biofilm—Insights from the application of a novel PF hydrogel model in vitro and in vivo. Front Cell Infect Microbiol 12: 1-7. https://doi.org/10.3389/fcimb.2022.826450
[53]	Al-Kafaween MA, Alwahsh M, Hilmi AB, et al. (2023) Physicochemical characteristics and bioactive compounds of different types of Honey and their biological and therapeutic properties: A comprehensive review. Antibiotics 6: 1-34. https://doi.org/10.3390/antibiotics12020337

This article has been cited by:

1.	Rania H.A. Emam, Ibrahim E. El-Sayed, Jiayu Xin, Xingmei Lu, Nour F. Attia, Innovative coating of cotton textile fabrics for integrating outstanding flame hazard safety, UV protection, tensile strength strengthening and antibacterial properties, 2024, 216, 09266690, 118752, 10.1016/j.indcrop.2024.118752
2.	Mahendra Rai, Chistiane M. Feitosa, Avinash P. Ingle, Patrycja Golinska, Harnessing bioactive nanocurcumin and curcumin nanocomposites to combat microbial pathogens: a comprehensive review, 2025, 0738-8551, 1, 10.1080/07388551.2025.2458006
3.	Mohd Hilmi Abu Bakar, Antibacterial Activity of Malaysian Trigona itama and Trigona thoracica Honey Against Gram-Negative and Gram-Positive Bacteria, 2025, 7, 2632-3834, 10.32388/JEYD13.3

Reader Comments

Your name:*

Email:*
© 2023 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)

通讯作者: 陈斌, bchen63@163.com

1.
沈阳化工大学材料科学与工程学院沈阳 110142

AIMS Microbiology

4.1 4.9

Metrics

Article views(2461) PDF downloads(131) Cited by(3)

Preview PDF

Download XML

Export Citation

Article outline

Show full outline

AIMS Microbiology

Comparative in vitro activity of various antibiotic against planktonic and biofilm and the gene expression profile in Pseudomonas aeruginosa