Research article

Preservation and post-harvest quality of okra using low density polyethylene

  • Received: 09 November 2020 Accepted: 13 January 2021 Published: 25 January 2021
  • Okra (Abelmoschus esculentus L. Moench) is a vegetable crop of high nutritional value, which presents great losses after harvest when stored under poor storage conditions. The objective of this research was to evaluate the effect of different low-density polyethylene (LDPE) thicknesses on the preservation and post-harvest quality of okra fruits under different storage periods. The experiment was conducted in a completely randomized design, with nine replicates, in a 5 × 5 factorial scheme, corresponding to five forms of packaging at a temperature of 10 ± 1 ℃: no film and four LDPE thicknesses (10, 20, 30, and 40 µm) with five storage periods (0, 7, 14, 21, and 28 days). It was revealed that the use of LDPE plastic films provided lower loss of mass, higher fruit firmness containment of increase in soluble solids, and lower color change at 21 days of storage compared to no film. The LDPE thickness of 30 µm showed lower incidence of rotting, better appearance throughout storage, lower color changes, containment of increase in soluble solids content, higher chlorophyll, ascorbic acid, and total phenolic content compared to other forms of packaging, and is the most appropriate package for storing okra fruits up to 21 days, under refrigeration condition. The results of this study show that the thickness of LDPE has significant effects on the conservation and quality of okra. Our findings can be used to minimize post-harvest losses of okra during marketing.

    Citation: Dalva Paulus, Sintieli Borges Ferreira, Dislaine Becker. Preservation and post-harvest quality of okra using low density polyethylene[J]. AIMS Agriculture and Food, 2021, 6(1): 321-336. doi: 10.3934/agrfood.2021020

    Related Papers:

    [1] Didi Darmadi, Ahmad Junaedi, Didy Sopandie, Supijatno, Iskandar Lubis, Koki Homma . Water-efficient rice performances under drought stress conditions. AIMS Agriculture and Food, 2021, 6(3): 838-863. doi: 10.3934/agrfood.2021051
    [2] Christos Dramalis, Demetrios Katsantonis, Spyridon D. Koutroubas . Rice growth, assimilate translocation, and grain quality in response to salinity under Mediterranean conditions. AIMS Agriculture and Food, 2021, 6(1): 255-272. doi: 10.3934/agrfood.2021017
    [3] Kartika Kartika, Jun-Ichi Sakagami, Benyamin Lakitan, Shin Yabuta, Isao Akagi, Laily Ilman Widuri, Erna Siaga, Hibiki Iwanaga, Arinal Haq Izzawati Nurrahma . Rice husk biochar effects on improving soil properties and root development in rice (Oryza glaberrima Steud.) exposed to drought stress during early reproductive stage. AIMS Agriculture and Food, 2021, 6(2): 737-751. doi: 10.3934/agrfood.2021043
    [4] Eric Tzyy Jiann Chong, Lucky Poh Wah Goh, Mariam Abd. Latip, Zaleha Abdul Aziz, Noumie Surugau, Ping-Chin Lee . Genetic diversity of upland traditional rice varieties in Malaysian Borneo based on mitochondrial cytochrome c oxidase 3 gene analysis. AIMS Agriculture and Food, 2021, 6(1): 235-246. doi: 10.3934/agrfood.2021015
    [5] Tineka R. Burkhead, Vincent P. Klink . American agricultural commodities in a changing climate. AIMS Agriculture and Food, 2018, 3(4): 406-425. doi: 10.3934/agrfood.2018.4.406
    [6] Farid Hellal, Mohamed Abdel-Hady, Ismail Khatab, Saied El-Sayed, Chedly Abdelly . Yield characterization of Mediterranean barley under drought stress condition. AIMS Agriculture and Food, 2019, 4(3): 518-533. doi: 10.3934/agrfood.2019.3.518
    [7] Panagiota Kazai, Christos Noulas, Ebrahim Khah, Dimitrios Vlachostergios . Yield and seed quality parameters of common bean cultivars grown under water and heat stress field conditions. AIMS Agriculture and Food, 2019, 4(2): 285-302. doi: 10.3934/agrfood.2019.2.285
    [8] Geovani S. de Lima, Vicente Elias da S. Neto, Hans R. Gheyi, Reginaldo G. Nobre, Genilson L. Diniz, Lauriane A. dos Anjos Soares, Pedro D. Fernandes, Fernandes A. de Almeida, Francisco Wesley A. Pinheiro . Photosynthetic pigments and photochemical efficiency of precocious dwarf cashew (Anacardium occidentale L.) under salt stress and potassium fertilization. AIMS Agriculture and Food, 2019, 4(4): 1007-1019. doi: 10.3934/agrfood.2019.4.1007
    [9] Noorhazira Sidek, Rosimah Nulit, Yap Chee Kong, Christina Yong Seok Yien, Rogayah Sekeli, Mariam F. EL-Barghathi . Callogenesis and somatic embryogenesis of Oryza sativa L. (cv. MARDI Siraj 297) under the influence of 2, 4-dichlorophenoxyacetic acid and kinetin. AIMS Agriculture and Food, 2022, 7(3): 536-552. doi: 10.3934/agrfood.2022033
    [10] Muhammad Fuad Anshori, Bambang Sapta Purwoko, Iswari Saraswati Dewi, Willy Bayuardi Suwarno, Sintho Wahyuning Ardie . Salinity tolerance selection of doubled-haploid rice lines based on selection index and factor analysis. AIMS Agriculture and Food, 2022, 7(3): 520-535. doi: 10.3934/agrfood.2022032
  • Okra (Abelmoschus esculentus L. Moench) is a vegetable crop of high nutritional value, which presents great losses after harvest when stored under poor storage conditions. The objective of this research was to evaluate the effect of different low-density polyethylene (LDPE) thicknesses on the preservation and post-harvest quality of okra fruits under different storage periods. The experiment was conducted in a completely randomized design, with nine replicates, in a 5 × 5 factorial scheme, corresponding to five forms of packaging at a temperature of 10 ± 1 ℃: no film and four LDPE thicknesses (10, 20, 30, and 40 µm) with five storage periods (0, 7, 14, 21, and 28 days). It was revealed that the use of LDPE plastic films provided lower loss of mass, higher fruit firmness containment of increase in soluble solids, and lower color change at 21 days of storage compared to no film. The LDPE thickness of 30 µm showed lower incidence of rotting, better appearance throughout storage, lower color changes, containment of increase in soluble solids content, higher chlorophyll, ascorbic acid, and total phenolic content compared to other forms of packaging, and is the most appropriate package for storing okra fruits up to 21 days, under refrigeration condition. The results of this study show that the thickness of LDPE has significant effects on the conservation and quality of okra. Our findings can be used to minimize post-harvest losses of okra during marketing.



    Rice (Oryza sativa) is a crop which is exposed to many environmental stresses. Inadequate water leading to drought stress is a common problem in upland cultivation systems. On average, rice needs 5,000 L of water to produce 1 kg of grain [1]. More than half of the 40 million hectares of rain-fed lowland rice worldwide suffers from water scarcity at some growth stage [2]. Drought stress reduces the rice growth, and severely affects the seedling biomass, photosynthesis, stomatal conductance, plant water relations and starch metabolism [3]. Depending on timing, duration and severity of the plant water deficit, the grain yield of some rice genotypes could be reduced by up to 81% under drought [4]. The application of potassium fertilisation has been reported to induce tolerance of plants to osmotic stress [5]. Potassium increases the plants' drought resistance through its functions in stomatal regulation, osmoregulation, energy status, charge balance, protein synthesis, and homeostasis [6]. In plants coping with drought stress, the accumulation of K+ may be more important than the production of organic solutes during the initial adjustment phase, because osmotic adjustment through ion uptake (such as K+) is more energy efficient [7].

    One of the strategies used by plants to overcome water stress is producing Late embryogenesis abundant (LEA) proteins. LEA proteins were initially discovered accumulating late in the embryogenesis of cotton seeds 25 years ago. LEA proteins were divided into several groups based on their different sequence/patterns or biased amino acid composition [7,8,9,10]. In addition, it was assumed that the majority of LEA proteins were hydrophilic due to biased amino acid composition [11] and natively unstructured, while some were in a folded structure. These proteins were also found accumulating in plant tissue that was exposed to environmental stress. LEA proteins play an important role in the dehydration tolerance mechanism as well as responding to cold and salinity stress [4,12,13,14,15]. The expression of the LEA gene is generally induced by accumulation of ABA and abiotic stress conditions such as cold and salinity stress, either in reproductive or vegetative tissues [8,16,17,18,19].

    Previous research studies have shown a small gap overlap between the gene's expression in vegetative tissues and in seeds, with a high level of expression found in seed tissues. A few papers have studied the functional properties of LEA proteins and shown that Arabidopsis dehydrin ERD10 binds to more water during drying than non-LEA control proteins [20,21] and the LEA proteins stabilise the dry sugar glasses on Typha latifolia [22] and Soybean [23]. These data indicate that LEA proteins are involved in cellular stabilisers during stress conditions. There exist a few reports on the expression of LEA genes of rice and other plants under environmental stress. However, there has been no documentation of LEA gene expression of rice under water stress, especially under potassium fertilisation to mitigate the drought effects. This information is important, and will be useful in rice cultivation under limiting water resources. It was hypothesised that the use of additional potassium fertilisation could mitigate the water stress effects by increasing rice tolerance to water stress by reducing the expression of the LEA gene and that this fertilisation would lead to better growth. A total of three treatments were involved, and these were arranged according to a completely randomized design (CRD), namely control (CF; Continuously flooding + 80 kg K2O/ha), water stress under standard potassium fertilisation (WS; Water Stress 25 days + 80 kg K2O/ha) and water stress under high potassium fertilisation (WSK; Water Stress 25 days + 120 kg K2O/ha). The aim of the present work was to study the LEA gene expression in, and the growth of, Malaysian Rice (MR220) exposed to water stress and potassium fertilisation; the purpose of this was to relate the expression of the LEA gene with the growth and yield of MR220 rice.

    A particular Malaysian rice variety (MR220) was grown in pots in a glasshouse at 28 ℃. At 15 Days After Sowing (15 DAS), the seedlings were transplanted into 9 new pots which were divided into 3 treatments, namely control (CF; Continuously flooding + 80 kg K2O/ha), water stress under standard potassium fertilisation (WS; Water Stress 25 days + 80 kg K2O/ha) and water stress under high potassium fertilisation (WSK; Water Stress 25 days + 120 kg K2O/ha). Each pot contained 4 seedlings, and during the earlier transplantation days (15–29 DAS), the water in the soil media was maintained at 5 cm level. Later, at 30 DAS, all water stress treatments were applied. For water stress treatments (WS and WSK), the rice seedlings were exposed to 25 days without any watering. The potassium fertilisation and timing for potassium rate treatments are summed up in Table 1. Other major fertilisers, such as Urea (46% N) and Triose super phosphate (46% P) were added as normal fertilisation and applied at 120 kg N/ha and 70 kg P2O5/ha respectively. Standard procedures of rice growing culture were followed throughout the studies.

    Table 1.  Schedule of potassium fertilization during the experiment.
    Treatments Description Potassium fertilisation schedule (muriate of potash; 60% K20)
    CF Continuously flooding + 80 kg K2O/ha (Control) 80 kg K2O/ha fertilisation split into two phases: 30%—3 leaves stage (15 DAS) 70%—booting (55 DAS)
    WS Water stress 25 days + 80 kg K2O/ha 80 kg K2O/ha fertilisation split into two phases: 30%—3 leaves stage (15 DAS) 70%—booting stage (55 DAS)
    WSK Water stress 25 days + 120 kg K2O/ha 120 kg K2O/ha fertilisation split into two phases: 30%—3 leaves stage (15 DAS) 70%—booting stage (55 DAS)

     | Show Table
    DownLoad: CSV

    Determination of plant growth (plant height, number of tillers and number of leaves) and yield components (grain yield and straw biomass) was carried out on randomly tagged plants by 3 replicates for each treatment. Plant height was measured from the plant base to the tip of the plant leaves. Total tillers and leaves were counted on the same day that the plant height data were collected. Days to flowering was calculated from the days of sowing until the first appearance of a panicle. Grain yield per pot was obtained from the weight of filled grains calculated at 14% moisture. To find the straw biomass, shoots were harvested by cutting about 2 cm above the soil, which involved excluding the grain. Following this, the samples were oven dried at 70 ℃ for 72 hours and weighed. Data were analysed via Proc ANOVA using SAS 9.2 (32). A mean separation test between treatments was performed using Least Significant Different. LSD and standard error of differences between means were calculated with the assumption that data were normally distributed and equally replicated.

    With regards the isolation of total RNA, at 60 DAS, the fresh tissue samples from the plant leaves were pooled and homogenised under liquid nitrogen. Total RNA was isolated by using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Approximately 30 µg of total RNA was treated with Rnase-free Dnase. The purity and concentration of total RNA were measured using a spectrophotometer (Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies)). Only the RNA samples with 260/280 ratio (an indication of protein contamination) between 1.9–2.1 and 260/230 ratio (an indication of reagent contamination) greater than 2.0 were used for the analysis. The integrity of RNA samples was determined using agarose gel electrophoresis.

    First-strand cDNA was synthesised by reverse transcribing 5 µg of total RNA in a final reaction volume of 100 µL using a Bioteke Super RT Kit according to the manufacturer's instructions. The PCR mixture contained 2 µL of diluted cDNA, 10 µL of 2xSYBR Green PCR Master Mix (Applied Biosystem, USA), 8 µL of nuclease-free water and 1 µL of each gene-specific primer in a final volume of 20 µL. The primer sequences are listed in Table 2. PCRs with no template control (NTC) for each primer pair were also performed. The real time PCR was performed by employing CFX96 Touch System and software (CFX Manager) by BIORAD. The expression on 18S rRNA and GAPDH3 was determined by PCR and gel electrophoresis to normalise the data. The qRT-PCR was performed with the reference genes 18S rRNA and GAPDH3, while the cycle was as follows: 3 min at 95 ℃, 40 cycles of 3 min at 95 ℃ and 1 min at 56 ℃, melting curve analysis by 65 ℃ to 95 ℃ and hold stage at 10 ℃. The procedure was carried out according to the manufacturer's instructions (CFX 96 Real Time System, Biorad). Two biological replicates for each sample were used for qRT-PCR analysis and three technical replicates were analysed for each biological replicate. The quantitative variation between different treatments was evaluated using the 2(-Delta Delta C(T)) method [24], and the amplification of 18S rRNA and GAPDH3 were used as internal controls to normalise the data.

    Table 2.  Targeted gene (LEA 7) and reference genes (18S rRNA and GAPDH3) and their primer sequences used for real time PCR analysis.
    Gene Name Gene description Forward primer (5' → 3') Reverse primer (5' → 3')
    LEA 7 Late Embryogenesis Abundant ATCTGCTCCGCGTCAACTAC AGAGGTGCACGAAGAACCAG
    18S rRNA 18S ribosomal RNA CTACGTCCCTGCCCTTTGTACA ACACTTCACCGGACCATTCAA
    GAPDH3 Glyceraldehyde 3-phosphate dehydrogenase GGT GTC CAA GAA GAC CCT CG GAG GAT GCC TTG AGC TCG TT

     | Show Table
    DownLoad: CSV

    The result indicated that the treatments significantly influenced the growth performance and grain yield (p ≤ 0.05; Table 3), but no significant on straw biomass. This was shown by the significant difference in plant height, number of leaves, number of tillers, days to flowering, and grain yield (Table 3). Generally speaking, it was found that WSK was not significantly different from WS in terms of days to flowering, although the application of WSK was shown to reduce the water stress effect by producing higher plant height, a greater number of leaves and a greater number of tillers compared to WS treatments. In addition, WSK obtained more yield, up to 63%, compared to WS, thus minimising yield reduction compared to CF. This result showed that increasing the potassium rate from 80 kg K2O/ha to 120 kg K2O/ha could minimise the water stress effect and enhance plant growth by shortening the number of days of flowering, optimising plant height, increasing the number of leaves and tillers, and enhancing grain yield under water stress condition.

    Table 3.  Growth and yield performance of MR220 variety as influenced by the treatments.
    Treatments Plant Height, cm Leaves No./hill Tillers No./hill Days to Flowering Grain yield (g/pot)
    CF 102.89 ± 0.44a 22 ± 0.33c 5 ± 0.17a 80 ± 1.25a 91.403 ± 1.99a
    WS 95.22 ± 0.45c 25 ± 0.44b 4 ± 0.29b 74 ± 1.20b 45.907 ± 3.19c
    WSK 98.78 ± 0.89b 29 ± 0.22a 5 ± 0.22a 77 ± 0.67b 75.163 ± 2.94b
    *Note: Data are means ± standard error of differences between means. Means not sharing a common single letter were significantly different at p ≤ 0.05.

     | Show Table
    DownLoad: CSV

    When comparing WS to CF, WS plants showed to have fewer days of flowering, thus illustrating that the imposition of water stress can enhance the efficiency of assimilate partitioning, which reduce time to flowering in rice. Although under water stress condition time to flowering was reduced this could also caused a reduction in plant height and number of tillers, which would have been unfavourable for plant growth performance. The reduction percentage of plant height was approximately 7.45% under WS, and 4% under WSK compared to the control. The present data showed that the WSK treatments could mitigate water stress effect and sustain plant growth performance. It was found that the imposition of water stress for 25 days with 120 kg K2O/ha in MR220 rice was able to mitigate water stress effects and showed the best practice in tackling water scarcity of rice cultivation in Malaysia. Similar results were also found by Hara [25], Khan [26], Lindhauer [27], Mohd Zain et al. [28] and Aown et al. [29], who showed that the vegetative growth of rice under abiotic stress can be improved with the application of potassium fertilisation.

    The primers in the current study were designed with amplicon lengths of 70 to 150 bp, yielding primers with an 18 to 24 base and a melting temperature of 58–62 ℃. 18S rRNA and GADPH3 were chosen as reference genes based on their stable expression in rice. 18S rRNA was found to be a reliable reference gene for normalisation of qRT-PCR data in rice [30]. GADPH3 was a suitable reference gene in measuring gene expression in sugarcane [31] and was compatible with rice, since rice is homologous to sugarcane. High-quality total RNA for each sample was isolated from leaves' tissue samples and reverse transcribed. Following this, for each biological replicate, the same cDNA pool was used for qRT-PCR analysis of each gene using gene-specific primers. Real time PCRs were performed in triplicate for each cDNA sample along with no template control in parallel for each gene. Agarose gel electrophoresis showed that LEA 7, GADPH3 and 18S rRNA amplified a single PCR product of desired size from cDNA pools (Figure 1).

    Figure 1.  Agarose gel (1.5%) stained with Midori Green showing amplification of a specific PCR product of expected size for each gene in rice study. (a) on LEA and GAPDH; (b) 18S rRNA (each sample lane is loaded with 20 µL of PCR product, while the marker lane is loaded with 2.5 µL of 50 ng/µL of DNA ladder) (NTC = No template control; LEA = LEA 7; GAPDH = GAPDH3; M = Fermentas 100bp DNA Ladder).

    Real time PCR analysis is very sensitive, highly specific, and has a large quantification range to seven orders of magnitude [32,33]. Thus, it has become the most common method in evaluating gene expression. The relative expression of the LEA 7 gene with 18S rRNA and GAPDH3 as the reference genes was determined using the 2(-Delta Delta C(T)), 2−ΔΔCTmethod [24]. The results are shown in Figure 2. Amplification efficiencies for the LEA 7, 18S rRNA and GAPDH3 genes were previously shown to be in the range of 99.5–100.5%. The relative expression of the LEA 7 gene was found to be 10.63- and 6.82-fold in WS and WSK respectively compared to the control (Figure 2). The result indicated that the induction of the LEA 7 gene in leaves tissue of rice was influenced by water stress and potassium rates. The increase of potassium fertilisation from WS (80 kg K2O/ha) to WSK (120 kg K2O/ha) under water stress 25 days condition was shown to reduce the expression of the LEA gene in WSK. The present result is in agreement with previous work focused on the alleviation of water stress with potassium fertilisation in rice, sunflowers, olives, sugarcane and fava beans [34,35,36,37,38,39].

    Figure 2.  Relative quantification of LEA 7 gene in the sample (WS relative to control sample and sample WSK relative to the control sample).

    Under water stress, plants receive and transmit stress signals to a cellular defence mechanism. One of the mechanisms involved is induction of the LEA proteins, which play an important role in drought tolerance [40,41]. It can be concluded, based on the present result, that water stress does enhance LEA gene expression and reduce plant growth performance, although this can be minimised by applying additional potassium fertiliser to the plant, thus suggesting that potassium plays a role in minimising plant abiotic stress, and especially water stress.

    The imposition of water stress for 25 days with additional 120 kg K2O/ha (WSK) was proven to reduce LEA gene expression accompanied by high performance in plant growth and grain yield. Meanwhile, water stress for 25 days with 80 kg K2O/ha (WS) was shown to lead to the highest induction of the LEA gene in tissues with a reduction in plant growth and grain yield. Therefore, increasing the amount of potassium fertiliser during water stress could reduce expressions of the LEA gene and thus act as one of the factors that could improve plant growth performance under drought condition.

    We sincerely thank the universities for the facilities and research funding [BK076-2017, GPF009B-2018 and Long-term Research Grant Scheme (LRGS)].

    The authors declare no conflict of interest.



    [1] Kyriakopoulou OG, Arens P, Pelgrom KTB, et al. (2014) Genetic and morphological diversity of okra (Abelmoschus esculentus L. Moench.) genotypes and their possible relationships, with particular reference to Greek landraces. Sci Hortic 171: 58-70. doi: 10.1016/j.scienta.2014.03.029
    [2] Kumar S, Parekh MJ, Fougat RS, et al. (2017) Assessment of genetic diversity among okra genotypes using SSR markers. J Plant Biochem Biotechnol 26: 172-178. doi: 10.1007/s13562-016-0378-2
    [3] Petropoulos S, Fernandes Â, Barros L, et al. (2018) Chemical composition, nutritional value and antioxidant properties of Mediterranean okra genotypes in relation to harvest stage. Food Chem 242: 466-474. doi: 10.1016/j.foodchem.2017.09.082
    [4] Mota WF, Finger FL, Cecon PR, et al. (2010) Preservation and postharvest quality of okra under different temperatures and forms of storage. Hortic Bras 28: 12-18. doi: 10.1590/S0102-05362010000100003
    [5] Finger FL, Della-Justina ME, Casali VWD, et al. (2008) Temperature and modified atmosphere affect the quality of okra. Sci Agric 65: 360-364. doi: 10.1590/S0103-90162008000400006
    [6] Rani M, Singh J, Kumar D (2015) Effect of different packaging material on chlorophyll and ascorbic acid content of the okra. South Asian J Food Technol Environ 1: 86-88. doi: 10.46370/sajfte.2015.v01i01.12
    [7] Mantilla SPS, Mano SB, Vital HC, et al. (2010) Modified atmosphere in food preservation. Acad J Agric Environ Sci 8: 437-448.
    [8] Alvares CA, Stape JL, Sentelhas PC, et al. (2013) Köppen's climate classification map for Brazil. Meteorol Z 22: 711-728. doi: 10.1127/0941-2948/2013/0507
    [9] Chitarra MIF, Chitarra AB (2005) Postharvest of fruits and vegetables: physiology and handling. Lavras: FAEPE, 785.
    [10] Arnon DI (1949) Copper enzyme in isolated chloroplasts polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1-15. doi: 10.1104/pp.24.1.1
    [11] Instituto AL (2008) Physico-chemical methods for food analysis. 4 Eds., Sã o Paulo: Intituto Adolfo Lutz, 1020.
    [12] Singleton VL, Orthofer R, Lamuela-Raventors RM (1999) Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods in Enzymol 299: 152-178. doi: 10.1016/S0076-6879(99)99017-1
    [13] Statistical Analysis System. SAS Studio (2017) Available from: http://www.sas.com/en_us/software/university-edition.html//.
    [14] Sanches J, Valentini SRT, Benato E, et al. (2011) Modified atmosphere and refrigeration for the postharvest conservation of 'Fukuhara' loquat. Bragantia 70: 455-459. doi: 10.1590/S0006-87052011000200029
    [15] Babarinde GO, Fabunmi OA (2009) Effects of packaging materials and storage temperature on quality of fresh okra (Abelmoschus esculentus) fruit. Agric Trop Subtrop 42: 151- 156.
    [16] Singh S, Chaurasia SNS, Prasad I, et al. (2020) Nutritional quality and shelf life extension of capsicum (Capsicum annum) in expanded polyethylene biopolymer. Asian J Dairy Food Res 39: 40-48. doi: 10.18805/ajdfr.DR-1506
    [17] Sanches J, Antoniali S, Passos FA (2012) Use of modified atmosphere in the post-harvest conservation of okra. Hortic Bras 30: 65-72.
    [18] Kader AA (2002) Postharvest technology of horticultural crops. Oakland: University of California, Agriculture and Natural Resources, 535.
    [19] Silva JS, Finger FL, Corrêa PC (2000) Fruit and vegetable storage. In: Silva JS (Ed.). Drying and Storage of Agricultural Products. Viçosa: Editora Aprenda Fácil, 469-502.
    [20] Rupollo G, Gutkoski C, Martins IR, et al. (2006) Effect of humidity and hermetic storage period on natural contamination by fungi and production of mycotoxins in oat grains. Ciência e Agrotecnologia 30: 118-125. doi: 10.1590/S1413-70542006000100017
    [21] Sanches J, Cia P, Antoniali S, et al. (2009) Quality of minimally processed broccoli from organic and conventional cultivation. Hortic Bras 27: 830-837.
    [22] Santos AF, Silva SM, Alves RE (2006) Storage of Suriname cherry under modified atmosphere and refrigeration: I-postharvest chemical changes. Rev Bras Frutic 28: 36-41. doi: 10.1590/S0100-29452006000100013
    [23] Moretti CL, Pineli LLO (2005) Chemical and physical quality of eggplant fruits submitted to different postharvest treatments. Food Sci Technol 25: 339-344. doi: 10.1590/S0101-20612005000200027
    [24] Mahajan BV, Dhillon WS, Siddhu MK, et al. (2016) Effect of packaging and storage environments on quality and shelf life of bell pepper (Capsicum annum L.). Indian J Agric Res Sci 86: 738-742.
    [25] Nascimento IB, Ferreira LE, Medeiros JF, et al. (2013) Post-harvest quality of okra submitted to different saline water laminas. Agropecuária Científica no Semiárido 9: 88-93.
    [26] Dhall RK, Sharma SR, Mahajan BVC (2012) Development of post-harvest protocol of okra for export marketing. J Food Sci Technol 51: 1622-1625. doi: 10.1007/s13197-012-0669-0
    [27] Saberi B, Golding JB, Marques JR, et al. (2018) Application of biocomposite edible coatings based on pea starch and guar gum on quality, storability and shelf life of 'Valencia'oranges. Postharvest Biologyand Technol 137: 9-20. doi: 10.1016/j.postharvbio.2017.11.003
    [28] Chauhan OP, Nanjappa C, Ashok N, et al. (2015) Shellac and aloevera gel based surface coating for shelf life extension of tomatoes. J Food Sci Technol 52: 1200-1205. doi: 10.1007/s13197-013-1035-6
    [29] Arango ZTM, Rodríguez MC, Campuzano OIM (2010) Frutos de uchuva (Physalis peruviana L.) ecotipo 'Colombia' mínimamente procesados, adicionados con microorganismos probióticos utilizando la ingeniería de matrices. Rev Fac Nac Agron Medellin 63: 5395-5407.
    [30] Costa AS, Ribeiro LR, Koblitz MGB (2011).Use of controlled and modified atmosphere in climacteric and non-climacteric fruits. Biol Sci Sitientibus Ser 11: 1-7.
    [31] Gong Y, Mattheis JP (2003) Effect of ethylene and 1-methylclopropene on chlorophyll catabolism of broccoli florets. Plant Growth Regul 40: 33-38. doi: 10.1023/A:1023058003002
    [32] Hörtensteiner S (2013) Update on the biochemistry of chlorophyll breakdown. Plant Mol Biol 82: 505-517. doi: 10.1007/s11103-012-9940-z
    [33] Plaza L, Sanchez-Moreno C, Elez-Martinez P, et al. (2006) Effect of refrigerated storage on Vitamin C and antioxidant activity of orange juice processed by high pressure or pulsed electric fields with regard to low pasteurization. Eur Food Res Technol 223: 487-493. doi: 10.1007/s00217-005-0228-2
    [34] Manas D, Bandopadhyay PK, Chakravarty A, et al. (2013) Changes in some biochemical characteristics in response to foliar applications of chelator and micronutrients in green pungent pepper. Int J Plant Physiol, Biochem 5: 25-35.
    [35] Howard LR, Talcott ST, Brenes CH, et al. (2000) Changes in phytochemical and antioxidant activity of selected pepper cultivars (Capsicum sp.) as influenced by maturity. J Agric Food Chem 48: 1713-1720. doi: 10.1021/jf990916t
    [36] Martins S, Mussatto S, Martinez Avila G, et al. (2011) Bioactive phenolic compounds: Production and extraction by solid-state fermentation. A review. Biotechnol Adv 29: 365-373.
    [37] Marinova D, Ribarova F, Atanassova M (2005) Total phenolics and flavonoids in Bulgarian fruits and vegetables. J Chem Technol Metall 40: 255-260.
    [38] Sreeramulu D, Raghunath M (2010) Antioxidant activity and phenolic content of roots, tubers and vegetables commonly consumed in India. Food Res Int 43: 1017-1020. doi: 10.1016/j.foodres.2010.01.009
  • Reader Comments
  • © 2021 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Metrics

Article views(8241) PDF downloads(471) Cited by(2)

Figures and Tables

Figures(1)  /  Tables(6)

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog