Citation: Noor Riyadh Thiab, Nicola King, Mary McMillan, Amer Almashhadany, Graham L Jones. Age-related protein and mRNA expression of glutathione peroxidases (GPx) and Hsp-70 in different regions of rat kidney with and without stressor[J]. AIMS Molecular Science, 2016, 3(2): 125-137. doi: 10.3934/molsci.2016.2.125
| [1] | Viktor Semenkov, Anatolii Mikhalskii, Alexandr Sapoznikov . Influence of heat shock proteins in individual sensitivity of human neutrophils to heat stress. AIMS Molecular Science, 2019, 6(2): 38-51. doi: 10.3934/molsci.2019.2.38 |
| [2] | Zhaoping Qin, Patrick Robichaud, Taihao Quan . Oxidative stress and CCN1 protein in human skin connective tissue aging. AIMS Molecular Science, 2016, 3(2): 269-279. doi: 10.3934/molsci.2016.2.269 |
| [3] | Akshaj Pole, Manjari Dimri, Goberdhan P. Dimri . Oxidative stress, cellular senescence and ageing. AIMS Molecular Science, 2016, 3(3): 300-324. doi: 10.3934/molsci.2016.3.300 |
| [4] | Dora Brites . Cell ageing: a flourishing field for neurodegenerative diseases. AIMS Molecular Science, 2015, 2(3): 225-258. doi: 10.3934/molsci.2015.3.225 |
| [5] | Sayeeda Ahsanuddin, Minh Lam, Elma D. Baron . Skin aging and oxidative stress. AIMS Molecular Science, 2016, 3(2): 187-195. doi: 10.3934/molsci.2016.2.187 |
| [6] | Peter X. Shaw, Travis Stiles, Christopher Douglas, Daisy Ho, Wei Fan, Hongjun Du, Xu Xiao . Oxidative stress, innate immunity, and age-related macular degeneration. AIMS Molecular Science, 2016, 3(2): 196-221. doi: 10.3934/molsci.2016.2.196 |
| [7] | Francisco Les, Zsuzsa Iffiú-Soltész, Josep Mercarder, Christian Carpéné . Tyramine activates lipid accumulation in rat adipocytes: influences of in vitro and in vivo administration. AIMS Molecular Science, 2017, 4(3): 339-351. doi: 10.3934/molsci.2017.3.339 |
| [8] | Fumiaki Uchiumi, Akira Sato, Masashi Asai, Sei-ichi Tanuma . An NAD+ dependent/sensitive transcription system: Toward a novel anti-cancer therapy. AIMS Molecular Science, 2020, 7(1): 12-28. doi: 10.3934/molsci.2020002 |
| [9] | Giulia Ambrosi, Pamela Milani . Endoplasmic reticulum, oxidative stress and their complex crosstalk in neurodegeneration: proteostasis, signaling pathways and molecular chaperones. AIMS Molecular Science, 2017, 4(4): 424-444. doi: 10.3934/molsci.2017.4.424 |
| [10] | Yu Sato, Hiroyuki Jinnouchi, Atsushi Sakamoto, Anne Cornelissen, Masayuki Mori, Rika Kawakami, Kenji Kawai, Renu Virmani, Aloke V. Finn . Calcification in human vessels and valves: from pathological point of view. AIMS Molecular Science, 2020, 7(3): 183-210. doi: 10.3934/molsci.2020009 |
Ageing is a complex process that is characterised by a general decline in physiological function, leading to increasing morbidity and eventual mortality [1,2]. There is increasing evidence for an age-related decline in renal function, both in animal models and in humans [3,4,5,6,7,8,9]. Several studies have demonstrated that this deterioration is manifested in both structural (tubular atrophy, glomerulosclerosis and interstitial fibrosis) and functional (reduced drug excretion, proteinuria, reduced ability to concentrate or dilute urine, impairment of electrolyte and ion transport, decreases in glomerular filtration rate (GFR), alteration in hormonal functions) changes in the kidney. The molecular and cellular mechanisms underlying these changes are currently under active investigation [2,10,11,12]. There is some suggestion that the damage caused by endogenously produced oxidants may contribute to the age-related changes [13,14,15,16]. Such oxidants including superoxide, hydrogen peroxide, hydroxyl radicals, and possibly singlet oxygen can induce damage to cellular macromolecules, including proteins, lipids and DNA [14,15,17,18,19]. The antioxidant enzymes scavenging active oxygen species have been suggested as key factors in determining the longevity of animals [19,20,21]. Indeed, there are correlations between levels of these enzymes and the maximum life span potential of different species [22,23]. Glutathione peroxidase is a major hydrogen peroxide scavenger enzyme, found in both the cytosol and mitochondria. The enzyme and its substrate GSH, form a formidable defence against hydrogen peroxides and lipid peroxides [24,25], although the role of other anti-oxidant enzymes such as catalase should not be overlooked [26].
The so-called heat shock (HS) response is one of the primordial intracellular defence mechanisms against stress. Exposure of cells and organisms to stresses such as high temperature, caloric restriction, exercise, oxidative and osmotic stress, heavy metals, proteasome inhibitors, amino acid analogues, ethanol, glutathione depletion, calcium ionophores and metabolic poisons are among many factors that induce the cellular stress response, leading to the preferential transcription and translation of heat shock proteins (Hsps) [27,28,29]. Optimal HS response in terms of Hsp synthesis and activity is essential for cell survival. By contrast, an inefficient and altered HS response has been implicated in abnormal growth and development [30], accelerated ageing and apoptosis [31,32] and in the initiation and promotion of cancers [33,34]. Seen in this context, an elevated Hsp response provides a homeostatic mechanism to counter accumulated metabolic and environmental insults [35]. The age related attenuation of the expression of key anti-oxidant enzymes could thus be seen as amplifying such insults and therefore leading to a concomitant age related sustained increase in the expression of Hsp-70. This reciprocal relationship has been previously observed in the ageing rat brain [36]. The physiological cellular redox state is a balance between the levels of oxidising and reducing equivalents, such as reactive oxygen species (ROS) and endogenous antioxidants. It appears that during the ageing process an imbalance between oxidants and antioxidants may occur, leading to oxidative stress [24,37]. The free radical theory of ageing proposes that ageing itself and some age-related diseases are, at least in part, a consequence of oxidative stress [37,38,39].
It is hypothesised here that expression of antioxidant enzymes in the kidney may decrease either with age or under conditions of oxidative stress as oxidant homeostasis is compromised. The aim of this study was to investigate the effect of ageing on the expression of the major antioxidant enzyme GPx (1 and 4) in different regions of the kidney under control and oxidative stress conditions and to correlate such age related changes with the expression of Hsp-70 mRNA.
All experiments were approved and carried out under conditions complying with the Animal Ethics Committee of the University of New England (AEC09/152, EC10/036 and AEC11/100).
Male Wistar rats in varying age cohorts (5 weeks; 12 weeks; 36 weeks; and 60 weeks of age) were used. For each experiment, five animals from each age cohort were stunned and sacrificed by cervical dislocation. For protein assays kidneys were removed, snap frozen in liquid nitrogen and stored at −80 ℃ until use. For mRNA extraction 30 mg sections from the cortex, inner and outer medulla were dissected and placed into RNA later stabilisation solution (Qiagen, Hilden, Germany catalogue no. 76104) and stored at 4 ℃.
For SDS/PAGE and subsequent Western blotting analysis, tissue samples from the cortex, outer medulla, and inner medulla were dissected from frozen kidneys that were first thawed in ice cold phosphate buffered saline (PBS). Fifty mg of each tissue was incubated at room temperature 25 ℃ for 30 minwith PBS at a ratio of 1:1000 prior to homogenisation for 2 min (control condition). To model oxidative stress, parallel 50 mg tissue samples were placed in a0.2 mM H2O2 solution for 30min at room temperature (stress condition) prior to homogenisation. The resultant homogenates were centrifuged at 4000 rpm for 10 min at 4 ℃, and the supernatant was flash frozen and stored until later use. A thiobarbituric reactive substances assay was carried out to confirm the oxidative stress state of the tissue and this data is included in a separate publication [26].
A Bradford reagent assay was used to determine the total protein concentration in the tissue homogenates from the control or stressed condition, as per the manufacturer’s instructions.
Protein samples (50 mg) were prepared in reducing/denaturing gel loading buffer containing 250mM Tris-HCl, pH 6.8, 8%SDS, 8% beta-mercaptoethanol, and 0.02% bromophenol blue and heated at 100 ℃ for 10 minutes. Samples were separated on 10% SDS PAGE gels that included molecular weight marker proteins (Precision Plus Protein TM Kaleidoscope TM Standards No.161-0375, Bio-Rad). The separated proteins were electro-blotted onto nitrocellulose membrane (Life Science, Whatman, catalogue number 10402594). Membranes were blocked in 5% non-fat milk powder dissolved in TRIS buffered saline containing Triton (TBST) for one hour. Membranes were incubated with the following primary antibodies: mouse anti-GPx1 (1:6000; Abnova); goat anti-GPx4 (1:5000; Abnova); or mouse anti-β-actin (1:5000; Sigma-Aldrich), in blocking solution at room temperature for 2 hours with shaking followed by the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:10,000. Signals were visualized by incubating the probed membrane with Amersham ECL solution and luminescence was detected by exposing the membrane to X-ray film. Relative band densities were visualised and quantified on a Bio-Rad scanning densitometer (Bio-Rad Laboratories, Hemel Hempstead, UK) with incorporation into Molecular Analyst software (version 2.1 for Macintosh, Bio-Rad). The migration of target bands were compared with the position of migration of standard molecular weight marker proteins (Precision PlusÔ KaleidoscopeÔ , Bio-Rad).
Total RNA was extracted from tissue samples using an RNeasy Mini Kit (Qiagen), following the manufacturer’s instructions. RNA integrity was assessed by gel electrophoresis and the relative RNA concentration quantified by spectrophotometry. Complementary DNA (cDNA) was synthesised using a QuantiTect Reverse Transcription kit with integrated genomic DNA removal (Qiagen), following the manufacturer’s instructions.
qRT-PCR reactions were carried out in a Rotor-Gene Q thermal cycler (Qiagen). Each reaction contained Rotor Gene SYBR Green PCR kit (Qiagen), 0.5 µM each forward and reverse primer, and cDNA transcribed from 10 ng RNA. The cycling parameters are given in Table 1. The primers used in this study are shown in Table 2. The PCR reaction efficiency of each primer set was determined using a 5-fold serial dilution of pooled cDNA. The specific of the PCR products was determined by melt curve analysis and gel electrophoresis. Samples from five independent experiments were analysed in duplicate, with negative controls included in each assay.
| Temperature | Time | Cycle no. |
| 95 | 5 minute | 1 |
| 95 | 5 second | |
| 60 | 10 second | 40 |
| 72 | 5 minute | 1 |
DownLoad: CSV| Gene | Forward primer | Reverse primer | Product size (base pairs, bp) | Reference |
| Gpx1 | CAGTTCGGACATCAGGAGAAT | AGAGCGGGTGAGCCTTCT | 139 | [38] |
| Gpx4 | AACGTGGCCTCGCAATGA | GGGAAGGCCAGGATTCGTAA | 101 | [38] |
| Hsp70 | TCATCTCCTGGCTGGACTCT | CTAGCCAACACCCTGAGAGC | 228 | This study |
| β-actin | CCTGCTTGCTGATCCACA | CTGACCGAGCGTGGCTAC | 500 | [39] |
| All primers are written in the 5’ to 3’ position. | ||||
DownLoad: CSVWestern blot protein expression data were normalised to the expression of the housekeeping protein, β-Actin and expressed as mean ± Standard error of different kidney regions and different ageing cohorts.
For mRNA expression, threshold cycle (Ct) data was first converted to expression data using the delta-delta Ct method by normalisation to the housekeeping gene β-actin as described by Livak & Schmittgen [40].
Correlations of the expression of GPx1 and GPx4 were made using nonparametric correlation according to the method of Spearman.
Statistical significance between groups was determined using a Kruskal-Wallis nonparametric test with a Dunn post-test. Results are presented as mean ± S.E. Differences of p < 0.05 were considered significant.
The greatest level of GPx1 protein expression in the cortex occurred at 12 weeks (Figure 1a). There were no other differences between the control and stress conditions in the cortex. In the outer medulla the expression of GPx1 was greater at 12 weeks compared to 5 weeks under control conditions (Figure 1b). In the stressed outer medulla the expression of GPx1 at 12 and 36 weeks were signficantly greater than that at 60 weeks (Figure 1b). Under control conditions the expression of GPx1 was signficantly greater in the inner medulla at 12 weeks compared to 5 and 60 weeks (Figure 1c). Oxidative stress did not alter the age dependent expression of GPx1 in the inner medulla (Figure 1c). There were no signficant differences in β-actin expression in any kidney region under control or stress conditions.
Figure 1. GPx1 expression in different kidney regions. 1a. Effect of ageing in control and stress conditions on GPx1 protein expression in the kidney cortex. Shown here are representative Western Blots for each age and each condition for GPx1 and the house-keeping protein, β-actin. The graph shows the relative expression level of GPx1 at each age and in each condition based on band density and normalised to the expression of β-actin. Data shown are means ± SE of 5 kidneys from 5 different animals. * p < 0.01 vs. all other conditions. 1b. Effect of ageing in control and stress conditions on GPx1 expression in the outer medulla. * p < 0.01 vs control at 5 weeks; ** p < 0.05 vs stress at 60 weeks. 1c. Effect of ageing in control and stress conditions on GPx1 expression in the inner medulla. * p < 0.01 vs 5 and 60 weeks old under control conditions.
There were no signficant differences in the expression of GPx1 mRNA across the different regions and different ages (Figure 2). There were no signficant differences in this data.
Figure 2. Effect of ageing on GPx1 mRNA expression in different kidney regions. Bar graph of the levels of GPx1 mRNA expression relative to β-actin expression at 5, 12, 36 and 60 weeks in the kidney cortex, outer and inner medulla. Data shown are means ± SE of N = 5.
There was no correlation between GPx1 gene expression and protein expression across different ages in the cortex and inner medulla. GPx1 gene and protein expression in the outer medulla were signficantly correlated (p = 0.0005).
There were no signficant differences in the expression level of GPx4 protein in any of the regions under either control or stress conditions (Figure 3).
Figure 3. GPx4 Expression in the kidney. 3a. Effect of ageing in control and stress conditions on GPx4 protein expression in the kidney cortex. Shown here are representative Western Blots for each age and each condition for GPx4 and the house-keeper β-actin. The graph shows the relative expression level of GPx4 at each age and in each condition based on band density and normalised to the expression of β-actin. Western blots are representative of 3 such blots. Data shown in the graph is mean ± SE of 5 kidneys from 5 different animals. 3b. Effect of ageing and oxidative stress on GPx4 expression in the outer medulla. 3c. Effect of ageing and oxidative stress on GPx4 expression in the inner medulla.
No significant differences in the mRNA levels of GPx4 were detected in the cortex, outer and inner medulla at any age (Figure 4). There was no correlation between GPx4 gene and protein expression in any kidney region.
Figure 4. Effect of ageing on GPx4 mRNA expression in different kidney regions. Bar graph of the levels of GPx4 mRNA expression relative to β-actin expression at 5, 12, 36 and 60 weeks in the kidney cortex, outer and inner medulla. Data shown are means ± SE of N = 5.
Irrespective of region, the expression of Hsp-70 was greatest at 60 weeks (Figure 5).
Figure 5. Effect of ageing on Hsp-70 mRNA expression in different kidney regions. Bar graph of the levels of Hsp-70 mRNA expression relative to β-actin expression at 5, 12, 36 and 60 weeks in the kidney cortex, outer and inner medulla. Data shown are means ± SE of N = 5. * p < 0.01 vs. all other ages in the cortex. ** p < 0.01 vs. all other ages in the outer medulla and *** p < 0.001 vs. all other ages in the inner medulla.
Ageing is accompanied by changes in the structure and function of different organs and tissues [2]. In the rat kidney, ageing has been related to oxidative stress and enhanced ROS generation [25,41,42,43]. Several researchers have shownageing is associated with decreased expression of antioxidant enzymes [44,45]. In this study, we investigated the effect of age and oxidative stress on the expression of key antioxidant enzymes GPx1, GPx4 at the protein and mRNA level and key heat shock protein Hsp-70 at the mRNA level in the rat kidney. Importantly, we investigated the effect of ageing and oxidative stress on GPx1 and 4 protein expression in different regions of the kidney, therefore emphasising the possible functional significance of these changes.
The results of this study indicate that, under control conditions, GPx expression varies both with age and region of the kidney (Figure 6). GPx1 was expressed at a higher level in the cortex at 12weeks, whilst expression in the outer and inner medulla did not vary with age (Figure 1 and 2). This may be a reflection of the renal medulla being exposed to higher levels of oxidative stress compared with the cortex and that some aspect of this increased stress attenuates GPx1 expression. This suggestion is consistent with earlier reports [46,47] demonstrating that the outer medulla is subject to higher levels of oxidative stress by comparison with the renal cortex under control conditions. By contrast, GPx4 was not shown to be differentially expressed across the different regions of the kidney under control physiological conditions (Figures 3 and 4) indicating perhaps an increased resistance to the effects of oxidative stress by comparison with GPx1.
Figure 6. Schematic diagram of the results.
With the single exception of the outer medulla for GPx1, there was generally no correlation between the expression of GPx1/4 gene and protein across different kidney regions with age. This could be due to post-transcriptional or post-translational modifications, as for example GPx1 is known to be phosphorylated by cAbl and Arg tyrosine kinases [48].
The current study further demonstrates that exposure to a contrived oxidative stress (H2O2) did not really affect GPx1 and GPx4 protein expression compared with control conditions (Figures 1 and 3). Exposure to 0.2 mM H2O2 is a standard model for inducing oxidative stress in the kidneys[26]. In this study the impairment of renal function as a result of exposure to the contrived oxidative stress was not measured directly. One avenue for further study would be to investigate whether renal function is indeed impaired as a result of suchoxidative stress exposure, and also to determine the mechanisms underlying such putative impairment.
The results of this study also indicate that there is a relationship between age and GPx1 expression. Expression of GPx1 was found to be highest in young mature rats (12 weeks old) compared to older and younger animals (Figure 1). The age-related decrease of GPx1 expression is consistent with earlier reports [49]. Our results are also in agreement with reports [45] that investigated antioxidant enzyme activity and gene expression of GPx, GSH-red and CAT in Sprague Dawley rats, showing that aged rats exhibited lower enzymatic activities and diminished gene expression by comparison with young rats.
However, in contrast to the situation with GPx1, the results of this study indicate that expression of GPx4 did not vary with age under control physiological conditions (Figure 3). Interestingly, an earlier study by Gomes et al. [2] found that the expression of GPx remained unchanged during the ageing process of male Wistar Kyoto (WKY) rats. It should be noted, however, that this study did not discriminate between isoforms of GPx. Therefore the age-related decrease in GPx mRNA and enzyme activity previously observed [49] could be due to decreased production of specific isoforms of GPx, such as GPx1, rather than a general decrease in production of all isoforms. This would result in a decrease in overall GPx activity, and also explain why no change may be seen in GPx4 levels.
Given the well described nexus between oxidant homeostasis and stress protein expression, we were also interested in determining the effect of age on the heat shock response in the kidney. The results of this study suggest that expression of Hsp-70 varies with both kidney region and age (Figure 5). Overall, we observed that expression of Hsp-70 was significantly elevated in older animals (60 weeks old) compared to younger animals. This is in agreement with earlier reports[30,50,51,52,53], which confirm that expression of Hsp-70 is a useful biomarker of the heat shock transcriptional response to heat and physiological stresses in a number of ageing mammals. These authors and others have raised the possibility that age-dependent changes in cellular redox status, as exemplified by the increased production of reactive oxygen intermediates result in the accumulation of oxidatively modified proteins with reduced activity. Age related increased expression of the inducible chaperone Hsp-70, then, would be seen as a way of mitigating against these deleterious changes. In any event, our observations are in general agreement with earlier reports [35] showing increased expression of Hsp-70 in different brain regions and peripheral organs in different age male Wistar rats. These authors suggest that this response may reflect the age related accumulation of various posttranslational modifications including protein oxidation and glycation leading to damaged proteins and disturbed cellular homeostasis. Such age related epigenetic protein modifications may contribute to the generally observed constitutively elevated chaperone levels in ageing organisms [31]. Given the contribution of Hsp-70 to blocking apoptosis, an interesting avenue for further research might be to establish whether apoptosis is impaired as a result of age/oxidative stress, by examining expression of appropriate markers for apoptosis in the kidney.
After reaching a peak at maturity (12 weeks), GPx1 protein decreased with age in the cortex under control conditions. GPx4 protein and mRNA levels showed few comparable age-related changes. In contrast expression of the chaperone Hsp-70 mRNA greatly increased with age. Consistent GPx expression levels in the medulla through age could be important given the high exposure of this region of the kidneys to oxidative stress.
This research was conducted at the University of New England, Armidale, New South Wales, Australia and supported by a grant from the School of Science and Technology.
All authors declare no conflicts of interest in this paper.
| [1] |
Miyoshi N, Oubrahim H, Chock PB, et al. (2006) Age-dependent cell death and the role of ATP in hydrogen peroxide-induced apoptosis and necrosis. Proc Natl Acad Sci USA 103: 1727-1731. doi: 10.1073/pnas.0510346103
|
| [2] |
Gomes P, Simao S, Silva E, et al. (2009) Aging increases oxidative stress and renal expression of oxidant and antioxidant enzymes that are associated with an increased trend in systolic blood pressure. Ox Med Cell Longevity 2: 138-145. doi: 10.4161/oxim.2.3.8819
|
| [3] | Clark B (2000) Biology of renal aging in humans. Adv renal replacement therapy 7: 11-21. |
| [4] |
Davies I, Fotheringham AP, Faragher BE (1989) Age-associated changes in the kidney of the laboratory mouse. Age Ageing 18: 127-133. doi: 10.1093/ageing/18.2.127
|
| [5] | Epstein M (1996) Aging and the kidney. J Am Soc Nephrol 7: 1106-1122. |
| [6] |
Hirokawa K (1975) Characterization of age-associated kidney disease in Wistar rats. Mech Age Devel 4: 301-316. doi: 10.1016/0047-6374(75)90031-7
|
| [7] | Zhou XJ, Rakheja D, Yu XQ, et al. (2008) The aging kidney. Kidney int 74: 710-720. |
| [8] | Maurer G, Dieterle F, Perentes E, et al. (2013) Use of β-2-microglobulin to assess glomerular alterations and damage in the kidney. Google Patents. |
| [9] |
Lim BJ, Yang HC, Fogo AB (2014) Animal models of regression/progression of kidney disease. Drug Discovery Today: Disease Models 11: 45-51. doi: 10.1016/j.ddmod.2014.06.003
|
| [10] |
Gecit İ, Kavak S, Meral I, et al. (2011) Effects of shock waves on oxidative stress, antioxidant enzyme and element levels in kidney of rats. Biol Trace Element Res 144: 1069-1076. doi: 10.1007/s12011-011-9124-8
|
| [11] |
Subramanian MV, James T (2010) Age-related protective effect of deprenyl on changes in the levels of diagnostic marker enzymes and antioxidant defense enzymes activities in cerebellar tissue in Wistar rats. Cell Stress Chaperones 15: 743-751. doi: 10.1007/s12192-010-0177-y
|
| [12] | Carrillo MC, Alvarez MDL, Parody J, et al. (2012) Reactive oxygen species act as signaling molecules in liver carcinogenesis. http://dx.doi.org/10.5772/45966. |
| [13] |
Shigenaga MK, Hagen TM, Ames BN (1994) Oxidative damage and mitochondrial decay in aging. Proc Natl Acad Sci USA 91: 10771-10778. doi: 10.1073/pnas.91.23.10771
|
| [14] |
Fraga CG, Shigenaga MK, Park JW, et al. (1990) Oxidative damage to DNA during aging: 8-hydroxy-2’-deoxyguanosine in rat organ DNA and urine. Proc Natl Acad Sci USA 87: 4533-4537. doi: 10.1073/pnas.87.12.4533
|
| [15] |
Stadtman ER (1992) Protein oxidation and aging. Sci 257: 1220-1224. doi: 10.1126/science.1355616
|
| [16] |
El‐Sawalhi MM, Darwish HA, Mausouf MN, et al. (2013) Modulation of age‐related changes in oxidative stress markers and energy status in the rat heart and hippocampus: a significant role for ozone therapy. Cell Biochem Function 31: 518-525. doi: 10.1002/cbf.2930
|
| [17] | Harman D (1998) Aging and oxidative stress. J Int Fed Clin Chem 10: 24-27. |
| [18] |
Valavanidis A, Vlachogianni T, Fiotakis K, et al. (2013) Pulmonary oxidative stress, inflammation and cancer: respirable particulate matter, fibrous dusts and ozone as major causes of lung carcinogenesis through reactive oxygen species mechanisms. Int J Environ Res Public Health 10: 3886-3907. doi: 10.3390/ijerph10093886
|
| [19] | Wang CH, Wu SB, Wu YT, et al. (2013) Oxidative stress response elicited by mitochondrial dysfunction: implication in the pathophysiology of aging. Exp Biol Med 238: 450-460. |
| [20] |
Semsei I, Rao G, Richardson A (1991) Expression of supreoxide dismutase and catalase in rat brain as a function of age. Mech Ageing Develop 58: 13-19. doi: 10.1016/0047-6374(91)90116-H
|
| [21] | Wang P, Li CG, Qi Z, et al. (2015) Acute Exercise Induced Mitochondrial H2O2 Production in Mouse Skeletal Muscle: Association with p 66Shc and FOXO3a Signaling and Antioxidant Enzymes. Ox Med Cell Longevity 2015: 536456. |
| [22] |
Sohal R, Sohal BH, Brunk UT (1990) Relationship between antioxidant defenses and longevity in different mammalian species. Mech Ageing Devel 53: 217-227. doi: 10.1016/0047-6374(90)90040-M
|
| [23] |
Holmström KM, Finkel T (2014) Cellular mechanisms and physiological consequences of redox-dependent signalling. Nature Reviews Mol Cell Biol 15: 411-421. doi: 10.1038/nrm3801
|
| [24] | Pollack M, Leeuwenburgh C (1999) Molecular mechanisms of oxidative stress in aging: free radicals, aging, antioxidants and disease. Handbook of Oxidants and Antioxidants in Exercise. Amsterdam: Elsevier Science BV, 881-923. |
| [25] |
Vida C, Gonzalez EM, De la Fuente M (2014) Increase of oxidation and inflammation in nervous and immune systems with aging and anxiety. Curr Pharmaceut Design 20: 4656-4678. doi: 10.2174/1381612820666140130201734
|
| [26] |
Thiab NR, King N, Jones GL (2015) Effect of ageing and oxidative stress on antioxidant enzyme activity in different regions of the rat kidney. Mol Cell Biochem 408: 253-260. doi: 10.1007/s11010-015-2503-2
|
| [27] |
Feder ME, Hofmann GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Ann Rev Physiol 61: 243-282. doi: 10.1146/annurev.physiol.61.1.243
|
| [28] | Fehrenbach E, Niess A (1998) Role of heat shock proteins in the exercise response. Exercise Immunol Rev 5: 57-77. |
| [29] |
Jolly C, Morimoto RI (2000) Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst 92: 1564-1572. doi: 10.1093/jnci/92.19.1564
|
| [30] |
Neuer A, Spandorfer SD, Giraldo P, et al. (2000) The role of heat shock proteins in reproduction. Human Reproduction Update 6: 149-159. doi: 10.1093/humupd/6.2.149
|
| [31] |
Gabai VL, Meriin A, Yaglom JA, et al. (1998) Role of Hsp70 in regulation of stress-kinase JNK: implications in apoptosis and aging. FEBS Lett 438: 1-4. doi: 10.1016/S0014-5793(98)01242-3
|
| [32] |
Sőti C, Csermely P (2000) Molecular chaperones and the aging process. Biogeront 1: 225-233. doi: 10.1023/A:1010082129022
|
| [33] | Shipp CK, Watson K, Jones GL (2011) Associations of HSP90 client proteins in human breast cancer. Anticancer Res 31: 2095-2101. |
| [34] |
Boswell-Casteel RC, Johnson JM, Duggan KD, et al. (2015) Overproduction and biophysical characterization of human HSP70 proteins. Protein Expres Purif 106: 57-65. doi: 10.1016/j.pep.2014.09.013
|
| [35] |
Chin JH, Okazaki M, Hu ZW, et al. (1996) Activation of heat shock protein (hsp) 70 and proto-oncogene expression by alpha1 adrenergic agonist in rat aorta with age. J Clin Invest 97: 2316-2323. doi: 10.1172/JCI118674
|
| [36] |
Sharma S, Singh R, Kaur M, et al. (2010) Late-onset dietary restriction compensates for age-related increase in oxidative stress and alterations of HSP 70 and synapsin1 protein levels in male Wistar rats. Biogeront 11: 197-209. doi: 10.1007/s10522-009-9240-4
|
| [37] | Beckman KB, Ames BN (1998) The free radical theory of aging matures. Physiol Rev 78: 547-581. |
| [38] |
Harman D (1992) Free radical theory of aging. Mutation Research/DNAging 275: 257-266. doi: 10.1016/0921-8734(92)90030-S
|
| [39] |
Xiong Q, Xie P, Li H, et al. (2010) Acute effects of microcystins exposure on the transcription of antioxidant enzyme genes in three organs (liver, kidney, and testis) of male Wistar rats. J Biochem Mol Toxicol 24: 361-367. doi: 10.1002/jbt.20347
|
| [40] |
Sadi G, Eryilmaz N, Tütüncüoğlu E, et al. (2012) Changes in expression profiles of antioxidant enzymes in diabetic rat kidneys. Diabetes/Metabolism Research and Rev 28: 228-235. doi: 10.1002/dmrr.1302
|
| [41] | Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2ΔΔCT Method. Met 25: 402-408. |
| [42] |
Jung K, Henke W (1996) Developmental changes of antioxidant enzymes in kidney and liver from rats. Free Rad Biol Med 20: 613-617. doi: 10.1016/0891-5849(95)02090-X
|
| [43] |
Rikans LE, Hornbrook KR (1997) Lipid peroxidation, antioxidant protection and aging. Biochim Biophys Acta 1362: 116-127. doi: 10.1016/S0925-4439(97)00067-7
|
| [44] |
Cand F, Verdetti J (1989) Superoxide dismutase, glutathione peroxidase, catalase, and lipid peroxidation in the major organs of the aging rats. Free Rad Biol Med 7: 59-63. doi: 10.1016/0891-5849(89)90101-9
|
| [45] |
Sanz N, Diez-Fernández C, Andrés D, et al. (2002) Hepatotoxicity and aging: endogenous antioxidant systems in hepatocytes from 2-, 6-, 12-, 18-and 30-month-old rats following a necrogenic dose of thioacetamide. Biochim Biophys Acta 1587: 12-20. doi: 10.1016/S0925-4439(02)00048-0
|
| [46] |
Shih PH, Yen GC (2007) Differential expressions of antioxidant status in aging rats: the role of transcriptional factor Nrf2 and MAPK signaling pathway. Biogeront 8: 71-80. doi: 10.1007/s10522-006-9033-y
|
| [47] | Chen YF, Cowley Jr AW, Zou AP (2003) Increased H2O2 counteracts the vasodilator and natriuretic effects of superoxide dismutation by tempol in renal medulla. Am J Physiol 285: R827-R833. |
| [48] |
Cao C, Leng YM, Huang W, et al. (2003) Glutathione peroxidase 1 is regulated by the c-Abl and Arg tyrosine kinases. J Biol Chem 278: 39609-39614. doi: 10.1074/jbc.M305770200
|
| [49] |
Zou A-P, Li N, Cowley AW (2001) Production and actions of superoxide in the renal medulla. Hypertension 37: 547-553. doi: 10.1161/01.HYP.37.2.547
|
| [50] |
Rao G, Xia E, Richardson A (1990) Effect of age on the expression of antioxidant enzymes in male Fischer F344 rats. Mech Ageing Devel 53: 49-60. doi: 10.1016/0047-6374(90)90033-C
|
| [51] |
Verbeke P, Fonager J, Clark BFC, et al. (2001) Heat shock response and ageing: mechanisms and applications. Cell Biol Int 25: 845-857. doi: 10.1006/cbir.2001.0789
|
| [52] |
Lee YK, Manalo D, Liu AC (1996) Heat shock response, heat shock transcription factor and cell aging. Neurosignals 5: 180-191. doi: 10.1159/000109187
|
| [53] | Borkan SC, Emami A, Schwartz JH (1993) Heat stress protein-associated cytoprotection of inner medullary collecting duct cells from rat kidney. Am J Physiol 265: F333-F341. |
| [54] | Liu AYC, Lee YK, Manalo D, et al. (1996) Attenuated heat shock transcriptional response in aging: molecular mechanism and implication in the biology of aging, in Stress-Inducible Cellular Responses. Springer, 393-408. |
| 1. | Milena B. Silva, Ana P. D. Demasi, Elizabeth F. Martinez, Maristane L. Goudinho, Joarlene M. Soares, José L. C. Junqueira, Ney S. Araujo, Peroxiredoxin I expression in epithelial cells of buccal mucosa from patients exposed to panoramic X-rays: influence of the age, 2018, 22, 1432-6981, 1587, 10.1007/s00784-017-2254-4 |
Figures(6) / Tables(2)
Noor Riyadh Thiab, Nicola King, Mary McMillan, Amer Almashhadany, Graham L Jones. Age-related protein and mRNA expression of glutathione peroxidases (GPx) and Hsp-70 in different regions of rat kidney with and without stressor[J]. AIMS Molecular Science, 2016, 3(2): 125-137. doi: 10.3934/molsci.2016.2.125
| Temperature | Time | Cycle no. |
| 95 | 5 minute | 1 |
| 95 | 5 second | |
| 60 | 10 second | 40 |
| 72 | 5 minute | 1 |
DownLoad: CSV| Gene | Forward primer | Reverse primer | Product size (base pairs, bp) | Reference |
| Gpx1 | CAGTTCGGACATCAGGAGAAT | AGAGCGGGTGAGCCTTCT | 139 | [38] |
| Gpx4 | AACGTGGCCTCGCAATGA | GGGAAGGCCAGGATTCGTAA | 101 | [38] |
| Hsp70 | TCATCTCCTGGCTGGACTCT | CTAGCCAACACCCTGAGAGC | 228 | This study |
| β-actin | CCTGCTTGCTGATCCACA | CTGACCGAGCGTGGCTAC | 500 | [39] |
| All primers are written in the 5’ to 3’ position. | ||||
DownLoad: CSV| Temperature | Time | Cycle no. |
| 95 | 5 minute | 1 |
| 95 | 5 second | |
| 60 | 10 second | 40 |
| 72 | 5 minute | 1 |
| Gene | Forward primer | Reverse primer | Product size (base pairs, bp) | Reference |
| Gpx1 | CAGTTCGGACATCAGGAGAAT | AGAGCGGGTGAGCCTTCT | 139 | [38] |
| Gpx4 | AACGTGGCCTCGCAATGA | GGGAAGGCCAGGATTCGTAA | 101 | [38] |
| Hsp70 | TCATCTCCTGGCTGGACTCT | CTAGCCAACACCCTGAGAGC | 228 | This study |
| β-actin | CCTGCTTGCTGATCCACA | CTGACCGAGCGTGGCTAC | 500 | [39] |
| All primers are written in the 5’ to 3’ position. | ||||
