| Target gene | Forward | Reverse |
| GRIN2A | TCCGCCTTTCCGATTTGGG | GCGTCCAACTTCCCAGTTTTC |
| GRIN2B | CTGAGACTGAAGAACAGGAAGATGACCATC | CGGGACTGTATTCCGCATGCAGG |
Citation: Theresa A. Nicklas, Carol E. O'Neil. Prevalence of Obesity: A Public Health Problem Poorly Understood[J]. AIMS Public Health, 2014, 1(2): 109-122. doi: 10.3934/publichealth.2014.2.109
| [1] | Ziphozethu Ndlazi, Oualid Abboussi, Musa Mabandla, Willie Daniels . Memantine increases NMDA receptor level in the prefrontal cortex but fails to reverse apomorphine-induced conditioned place preference in rats. AIMS Neuroscience, 2018, 5(4): 211-220. doi: 10.3934/Neuroscience.2018.4.211 |
| [2] | Gigi Tevzadze, Tamar Barbakadze, Elisabed Kvergelidze, Elene Zhuravliova, Lali Shanshiashvili, David Mikeladze . Gut neurotoxin p-cresol induces brain-derived neurotrophic factor secretion and increases the expression of neurofilament subunits in PC-12 cells. AIMS Neuroscience, 2022, 9(1): 12-23. doi: 10.3934/Neuroscience.2022002 |
| [3] | Mazyar Zahir, Amir Rashidian, Mohsen Hoseini, Reyhaneh Akbarian, Mohsen Chamanara . Pharmacological evidence for the possible involvement of the NMDA receptor pathway in the anticonvulsant effect of tramadol in mice. AIMS Neuroscience, 2022, 9(4): 444-453. doi: 10.3934/Neuroscience.2022024 |
| [4] | Chris Cadonic, Benedict C. Albensi . Oscillations and NMDA Receptors: Their Interplay Create Memories. AIMS Neuroscience, 2014, 1(1): 52-64. doi: 10.3934/Neuroscience.2014.1.52 |
| [5] | Dai Mitsushima . Contextual Learning Requires Functional Diversity at Excitatory and Inhibitory Synapses onto CA1 Pyramidal Neurons. AIMS Neuroscience, 2015, 2(1): 7-17. doi: 10.3934/Neuroscience.2015.1.7 |
| [6] | Robert A. Moss, Jarrod Moss . The Role of Dynamic Columns in Explaining Gamma-band Synchronization and NMDA Receptors in Cognitive Functions. AIMS Neuroscience, 2014, 1(1): 65-88. doi: 10.3934/Neuroscience.2014.1.65 |
| [7] | Mani Pavuluri, Kelley Volpe, Alexander Yuen . Nucleus Accumbens and Its Role in Reward and Emotional Circuitry: A Potential Hot Mess in Substance Use and Emotional Disorders. AIMS Neuroscience, 2017, 4(1): 52-70. doi: 10.3934/Neuroscience.2017.1.52 |
| [8] | Nicholas J. D. Wright . A review of the direct targets of the cannabinoids cannabidiol, Δ9-tetrahydrocannabinol, N-arachidonoylethanolamine and 2-arachidonoylglycerol. AIMS Neuroscience, 2024, 11(2): 144-165. doi: 10.3934/Neuroscience.2024009 |
| [9] | Nao Fukuwada, Miki Kanno, Satomi Yoshida, Kenjiro Seki . Gαq protein signaling in the bed nucleus of the stria terminalis regulate the lipopolysaccharide-induced despair-like behavior in mice. AIMS Neuroscience, 2020, 7(4): 438-458. doi: 10.3934/Neuroscience.2020027 |
| [10] | Ruben Carvalho, Alisa N. Lukoyanova, João Casalta-Lopes, Nikolay V. Lukoyanov, Joana Isabel Soares . Plastic rearrangement of basal forebrain parvalbumin-immunoreactive neurons in the kainite model of epilepsy. AIMS Neuroscience, 2023, 10(4): 300-314. doi: 10.3934/Neuroscience.2023023 |
N-methyl-D-aspartate glutamate receptors (NMDARs) play a central role in learning, memory, and synaptic development, and are implicated in various neurological and psychiatric disorders [1],[2]. The function and biophysical features of NMDARs are mainly dictated by their subunit composition. The major variants of the GLUN2 subunit—GLUN2A and GLUN2B—are expressed in a spatio-temporal manner. NMDAR subunit expression and composition are controlled by various mechanisms, such as transcriptional regulation, differential trafficking of receptors, post-transcriptional modifications (e.g. phosphorylation), and protein-protein interactions in membrane macromolecular complexes [3]–[5]. Subcellular localization might be an additional regulator of their physiological and pathological functions, as some NMDA receptors are targeted to synaptic sites while others are inserted extrasynaptically. It is supposed that synaptic localization is more characterized for GLUN2A-containing NMDARs, whereas GLUN2B-enriched NMDARs are found in extrasynaptic membranes of the adult central nervous system (CNS). Different localization and composition is possibly associated with opposite effect on neural cell survival: downstream intracellular cascades of synaptic NMDARs promote cell survival, whereas excessive calcium influx by extrasynaptic NMDARs induces mitochondrial dysfunction and, consequently, cell death [6]. Among specific downstream effectors of synaptic NMDARs, cyclic-AMP response element binding protein (CREB) draws special attention because of its established role in neuronal survival [7],[8]. The inhibitory effect of extrasynaptic NMDAR activation on neuronal viability is mediated by a variety of signaling pathways, including inactivation of CREB and ERK1/2, and expression of pro-apoptotic genes. High surface mobility of GLUN2B-enriched NMDARs (250-fold higher than that of GLUN2A-enriched NMDARs) facilitates their regulated lateral diffusion, endocytosis, and recycling. This mobility process is controlled by several post-translational modifications, including phosphorylation, nitrosylation, and palmitoylation [9]. Mislocalization and abnormal expression and targeting of NMDAR subunits are implicated in several brain disorders and pathological conditions, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, schizophrenia, and stroke (reviewed in [3]).
Membrane delivery and stability of NMDARs depend on the integrity of the actin cytoskeleton [10]. The Rho family of guanosine triphosphatase (GTPase) proteins regulate neuronal structure and function, including neuronal actin dynamics. For example, Rac1, a member of the Rho GTPases, stimulates spine formation, dendrite arborization, elongation, and branching complexity [11]. The expression of Rac1 is significantly increased in the temporal lobe of patients with epilepsy and epilepsy model animals, suggesting that elevated Rac1 expression contributes to the pathophysiology of the disease [12]. In contrast, inhibition of Rac1 activity impairs NMDAR function and induces autism spectrum disorders (ASD)-like social deficits in animals. GLUN2B-containing NMDARs and signals predominantly through Rac promote LTD in hippocampal slices [13]. Activation of GLUN2B-containing NMDARs predominantly activates the downstream Rac/p38 pathway [14],[15].
Gut microbiota modulate host brain function and cognitive behavior, and contribute to the development of neurological disorders [16],[17]. Several species of gut Clostridium have been shown to produce a wide range of neurotoxins, including p-cresol—the end product of microbial degradation of tyrosine [18],[19]. P-cresol interferes with the conversion of dopamine to norepinephrine via covalent inactivation of dopamine beta-hydroxylase [20],[21]. Elevated dopamine and reduced norepinephrine levels are consistent with monoamine models of psychopathology, and accumulating evidence supports the role of dopaminergic dysfunction in certain neurological disorders [22].
Nevertheless, the functional link between p-cresol and NMDAR-dependent neurological disorders remains unexplored. Recently, we have shown that intraperitoneal injection of p-cresol induced autism-like behavior in healthy rats and accelerated seizure reactions in epilepsy-prone rats [23],[24]. These alterations were accompanied by the increased expression of GLUN2B in the nucleus accumbens (NAc) [25]. Based on these observations, we hypothesized that p-cresol could promote abnormal subcellular localization of NMDAR subunits and, consequently, alter the composition of synaptic and extrasynaptic NMDARs. In this study, we determined the amount of GLUN2B and GLUN2A, and assessed the activitity of CREB and Rac1 (downstream effectors of NMDARs) in healthy and epilepsy-prone rats following p-cresol treatment. We found that subchronic intraperitoneal injection of p-cresol induced differential expression of the two subunits between the hippocampi and NAc of healthy and epilepsy-prone rats, and altered their GLUN2B/GLUN2A ratio. Furthermore, p-cresol decreased the levels of phosphorylated CREB in both brain structures and stimulated Rac activity in the hippocampus. These data suggest that p-cresol specifically impairs NMDAR-dependent activity in the NAc and hippocampi of healthy and epilepsy-prone rats, and that this effect is mediated via mislocalization of NMDAR subunits.
Healthy Wistar rats and audiogenic seizure-prone Krushinski–Molodkina (KM) rats [26] (160–180 g) were randomly allocated into experimental and control groups, with 5 rats in each group. During the experiments, the rats were allowed water and standard laboratory chow ad libitum, and were maintained under controlled temperature (21–22 °C) and humidity (47 ± 2%), with 12-h light/dark cycle. The rats were housed in cages (transparent polycarbonate, 595 × 380 × 200 mm3), with 5 animals per cage. The experimental procedures and animal care and handling were performed in conformity with the European Communities Council Directive EU Directive 2010/63/EU for animal experiments. All experiments were approved by the Institutional Research Projects' Ethics Commission of Ilia State University.
Rats in the experimental and control groups received daily intraperitoneal injections of p-cresol (30 mg/kg per injection; Sigma-Aldrich) or isotonic saline, respectively, for 21 days. Three days after termination of injections, the animals were sacrificed and decapitated. Immediately after decapitation, their hippocampi and NAc were extracted, rapidly homogenized in an ice-cold buffer (20 mM Tris-HCl (pH 7.4), 0.32 M sucrose, 1 mM EDTA (ethylenediamine tetraacetic acid), 0.5 mM EGTA (ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid)) and a cocktail of protease inhibitors (Sigma-Aldrich), and centrifuged at 1000 × g for 10 min. The pellet (nuclear fraction) was collected and the supernatant centrifuged at 12 000 ×g for 15 min. The resulting supernatant (“cytosol fraction”) was collected and stored at −80 °C until further use, while the pellet (membrane fraction) was washed once and centrifuged as before. A concentrated solution of sodium dodecyl sulfate (SDS) was added to the membrane fraction to give a final concentration of 5%, and the sample was incubated at 4 °C for ≥1 h. Protein content of the membrane fraction was determined in quadruplicate using the Micro BCA Protein Assay Kit (cat. no. 23235, Pierce), according the manufacturer's protocol. All samples were stored at −80 °C until analysis.
Aliquots of the solubilized membrane fraction containing 30 µg of total protein in equal volume were applied to SDS gels (4–12%) and electrophoresed. The separated proteins were electroblotted onto 0.45-µm nitrocellulose membranes before the membranes were stained with Ponceau S solution to confirm uniform sample loading and efficient protein transfer. Subsequently, the membranes were blocked with 5% bovine serum albumin (BSA) in Tris-buffered saline with 0.1% Tween-20 (TBST), and incubated for 1h with antibodies against GLUN2B and GLUN2A (sc-390094 and sc-3655R97, 1:1000; Santa Cruz, USA). Following incubation, the membranes were washed in TBST and probed with species-appropriate peroxidase-conjugated affinity-purified secondary antibodies at room temperature for 1 h. After further washing in TBST, standard immunochemical procedures were carried out using chemiluminescent substrate (Santa Cruz, USA). The blots were exposed to X-ray films (Amersham) with intensifying screens to ensure linearity of response. The chemiluminescent bands were acquired and their intensities quantified using Image Lite Studio software.
Analysis of copy number variation (CNV) was based on qPCR [27]. DNA was extracted from the nuclear fraction using the Tissue DNA Extraction Kit (GeneON), according to the manufacturer's instructions. The DNA content of the preparations was determined using a NanoDrop spectrophotometer (ThermoFisher, USA) before the samples were diluted to ensure equal DNA concentration in each preparation. GRIN2A and GRIN2B genes (encoding GLUN2A and GLUN2B, respectively) were amplified by qPCR, using primers whose sequences are listed in Table 1.
Target gene expression was normalized to the housekeeping gene beta-actin. All primers used were purchased from Eurofins. Reverse transcription was performed using the Real-time-PCR Master Mix E3 (GeneON) containing EvaGreen, dUTP, and ROX. qPCR was carried out on QuantStudio 5 Real-Time PCR System (ThermoFisher, USA) using the following thermocycler conditions: 2 min at 95 °C; 40 cycles of 95 °C for 15 s, 59 °C for 30 s, and 72 °C for 33 s. The data were analyzed by comparing cycle threshold (Ct) values.
| Target gene | Forward | Reverse |
| GRIN2A | TCCGCCTTTCCGATTTGGG | GCGTCCAACTTCCCAGTTTTC |
| GRIN2B | CTGAGACTGAAGAACAGGAAGATGACCATC | CGGGACTGTATTCCGCATGCAGG |
DownLoad:
CSV
Rac activation assay was performed on the “cytosol fraction” containing equal total protein amount, using the Rac1,2,3 G-LISA Activation Assay Kit (Cytoskeleton, cat. no. BK125), according to the manufacturer's protocol. The results were expressed as optical density (OD) per mg of total protein.
The levels of Ser133-phosphorylated CREB were assessed in the nuclear fraction using the Human/Mouse/Rat Phospho-CREB (S133) DuoSet IC ELISA Kit (R&D Systems, cat. no. DYC2510-2), according to the manufacturer's protocol. The concentration of pCREB in each sample was calculated from the standard curve run with each assay, and expressed as ng of pCREB per mg of total protein.
OD values for GLUN2B and GLUN2A were analyzed with one-way ANOVA. Planned comparisons using two-tailed T-tests were performed to compare the groups. Statistix 9 (Analytical Software, Tallahassee, USA) was used for all statistical analyses.
Brain regions (the hippocampus and NAc) extracted from control and p-cresol-treated rats were used for the following analyses. Abnormal expression of GLUN2B and GLUN2A is implicated in both epilepsy and autism spectrum disorder [28]. Hence, primarily we determined the expression of those two proteins in rat brain tissue after treatment with p-cresol and GLUN2B/GLUN2A ratio were estimated. The results showed that the two subunits were differentially expressed in plasma membranes between the hippocampus and NAc in both healthy and KM rats (Figure 1).
Consequently, the GLUN2B/GLUN2A ratio was altered in both brain structures. In healthy, p-cresol-treated rats, the ratio was decreased in the hippocampus and increased in the NAc (Figure 2A) while the opposite effect was observed in p-cresol-treated KM rats (Figure 2B).
Several genetic studies have been conducted to elucidate the role of GRIN2A/GRIN2B genes in the molecular mechanism of the neurological pathologies [29]–[31]. Different copy number variants (CNVs are associated with disorders such as intellectual disability, autism, epilepsy, schizophrenia, and bipolar disorder [32]–[34]. Based on these observations, we performed qPCR to detect CNV gains and losses (deletion/duplication) in GRIN2A and GRIN2B. No significant differences in Ct (cycle threshold) values between the hippocampus and NAc and between untreated and p-cresol-treated rats were found (data not shown). These results indicate that the number of copies of GRIN2B and GRIN2A genes is the same in the NAc and hippocampi of healthy and KM rats, and that it is not affected by p-cresol. Thus, it could be suggested that epigenetic regulation of the expression of GRIN2A/GRIN2B genes, or post-transcriptional processes, may contribute to the differential spatio-temporal distribution of GLUN2B and GLUN2A NMDAR subunits [29].
The high lateral mobility of GLUN2B-containing receptors allows them to translocate between synaptic and extrasynaptic sites, and the GLUN2A/GLUN2B ratios may differ considerably between inputs [6]. Extrasynaptic GLUN1/GLUN2B receptors trigger major cell death pathways, leading to neuronal death [35], while activation of synaptic GLUN2A/GLUN2B-containing receptors may convey pro-survival cues [36] through CREB signaling [6]. Therefore, alterations in the GLUN2B/GLUN2A ratio may be caused by the increased expression of extrasynaptic GLUN2B. In the next experiment, we assessed the activity of CREB. We found that subchronic exposure to p-cresol decreased pCREB levels in the NAc of healthy rats and hippocampi of KM rats, without affecting its levels in the hippocampi of healthy rats and NAc of KM rats (Figure 3). CREB activity was negatively correlated with the amount of GLUN2B protein, suggesting that the observed changes in the GLUN2B/GLUN2A ratio are caused by an increase in extrasynaptic GLUN2B.
The Rho GTPases regulate the actin cytoskeleton and play an important role in the maintenance and reorganization of dendritic spines [37]. Therefore, we next sought to assess the activity of Rac1 in the NAc and hippocampi of healthy and KM rats. The results revealed that, following p-cresol treatment, the levels of active Rac1 were diminished in the NAc and elevated in the hippocampi of rats in both groups (Figure 4).
The hippocampus—the largest structure of the mesial temporal lobe, is usually the primary region of lesions and is responsible for majority of symptoms characterizing temporal lobe epilepsy (TLE). Experimental and clinical data also suggest involvement of the nucleus accumbens (NAс) in propagation of frontal and temporal lobe seizures as well as in behavioral modification [38]. Preclinical studies demonstrated that NAc had been involved in the progress of epilepsy and recurrent epilepsy caused neuronal degeneration via this region-related pathways [39]. It was shown that stimulation of the ventral tegmental area can either inhibit or facilitate the activity of NAc neurons driven by hippocampal input [40]–[42]. Hippocampal glutamatergic pathway in NAc neurons could modify the activity of this region through changes in postsynaptic density, presumably by increasing the number of GLUN2B-containing extrasynaptic NMDARs [43]. Conversely, NMDAR-dependent plasticity in the NAc is required for early stages of learning [44].
We have found that treatment of rats with p-cresol modified the expression of GLUN2B and GLUN2A subunits of NMDAR in the plasma membranes of NAc and hippocampal neurons, significantly changing their GLUN2B/GLUN2A ratio. Importantly, the ratio was altered in opposite directions in the two brain regions: it was increased in the NAc and decreased in the hippocampi of healthy rats, whereas in KM rats, the opposite result was observed. Considering that these changes might have been the result of distinct genomic programmes of synthesis and expression of GLUN2A and GLUN2B subunits in different brain structures, we analysed the copy numbers of GRIN2A and GRIN2B. No significant differences in the CNV of either gene were found between the NAc and hippocampus, and between untreated and p-cresol-treated rats. Thus, we propose that epigenetic regulation of GRIN2A/GRIN2B expression, or post-transcriptional processes, contribute to the differential spatio-temporal distribution of these NMDAR subunits.
To assess the physiological significance of changes in NMDAR subunit composition, we evaluated the activity of CREB—one of the most important signaling-dependent transcription factors whose role in neuronal survival, as well as in synaptic plasticity, neurogenesis, learning, and memory is well-documented [45],[46]. It is thought that GLUN2B localized in the extrasynaptic sites promotes CREB dephosphorylation. In contrast, synaptic NMDARs stimulate CREB phosphorylation [6], which, in turn, initiates synaptogenesis in the hippocampus and NAc [47],[48]. To determine the effect of changed ratio of subunits on the activity of one the key transcription factors–CREB, we have analyzed the phosphorylated form of this protein. We have found that administration of p-cresol impaired CREB phosphorylation in the NAc of healthy rats and hippocampi of KM rats while the level of phosphorylated CREB did not change in the hippocampi of saline-treated rats. An inverse correlation between the activity of CREB and the amount of GLUN2B protein was found, suggesting that elevated GLUN2B/GLUN2A ratio in the NAc of healthy rats and hippocampi of KM rats is due to an increase in extrasynaptic GLUN2B. These data suggest that p-cresol modulates the composition of NMDARs, leading to a reduction in synaptic plasticity in the NAc of normal rats and hippocampi of KM rats.
CREB-responsive genes promote dendritic arborization through stimulation of the Rac pathway [49]; thus, Rac activity should be positively correlated with CREB phosphorylation. However, our results have shown that the two were only correlated in the NAc, and that p-cresol inhibited both Rac activity and CREB phosphorylation. Conversely, in the hippocampus, Rac activity was stimulated by p-cresol, indicating that p-cresol exerts opposing effects on NAc and hippocampal cells.
The effects of p-cresol on the hippocampi and NAc of healthy and epilepsy-prone rats might be caused by the different anatomical and biochemical features of these structures. Considering that p-cresol alters dopamine metabolism, we propose that the variable effects of this toxin on the hippocampus and NAc are mediated by differences in the density and activity of dopaminergic pathways in the two brain regions. Both D1 and D2 dopamine receptors physically interact with NMDAR subunits, and dopaminergic ligands dynamically regulate this complex. Surface expression of NR1 and GLUN2B proteins was reported to increase in cultured prefrontal cortex neurons following exposure to a D1DR (D1 dopamine receptors) agonist [50],[51]. Additionally, D1 receptors mediate CREB phosphorylation via phosphorylation of NMDARs [52]. In a membrane fractionation study involving striatal tissue homogenates, activation of the D1 receptor triggered redistribution of NR1, GLUN2A, and GLUN2B to synaptosomal compartments [53]. Thus, we suppose that surface expression, and possibly redistribution, of NMDAR subunits in p-cresol-exposed brain depends on its dopamine concentration and on the docking of NMDAR subunits by dopamine receptor subtypes.
The changes to glutamate receptor composition in the hippocampi of epilepsy-prone, audio-sensitive rats appear to be the result of genetically determined variations in dopaminergic and glutamatergic systems in the brain. The striatal dopamine system of KM rats is different to that of healthy rats. Basal dopamine levels are 25% higher in brain dialysates of KM rats than in those of control rats, while D2 and NMDAR densities are compensatorily lowered [26]. Thus, the higher dopamine concentration in KM rats could contribute to the different effect of p-cresol on KM and healthy rats.
Chernigovskaya and colleagues [54] revealed that expression of VGLUT2 (glutamate transporter) and GLUN2B in KM rats increased until day 14 after birth, before dramatically decreasing in later stages of life. The genetically determined increase inERK1/2 signaling was also observed during postnatal ontogenesis of KM rats. The latter effect could be related to disturbances in the synthesis and activity of proteins regulating hippocampal glutamatergic transmission during the development of seizure susceptibility.
Collectively, our data suggest that interactions between the glutamatergic and dopaminergic systems play a central role in synaptic plasticity in the NAc and hippocampus exposed to the gut neurotoxin p-cresol. Elevation of dopamine levels in response to inhibition of dopamine beta-hydroxylase can alter the surface expression and subcellular localization of the DR-NMDA heteroreceptor in these brain regions, leading to changes in downstream effector activity and abnormal extrapyramidal motor and cognitive behaviors.
Subchronic intraperitoneal injection of p-cresol caused differential expression of GLUN2B and GLUN2A between murine hippocampi and NAc, and altered the GLUN2B/GLUN2A ratio differently in healthy and KM rats. These changes were accompanied by decreased CREB phosphorylation in both brain structures, and increased Rac activitiy in the hippocampus. These data suggest that p-cresol has distinct effects on NMDAR-dependent activity in the NAc and hippocampus in healthy and epilepsy-prone rats.
| [1] | Flegal KM, Carroll MD, Ogden CL, et al. (2010) Prevalence and trends in obesity among US adults, 1999-2008. JAMA 303(3): 235-241. |
| [2] | Ogden CL, Carroll MD, Curtin LR, et al. (2010) Prevalence of high body mass index in US children and adolescents, 2007-2008. JAMA 303(3): 242-249. |
| [3] | Flegal KM, Carroll MD, Kit BK, et al. (2012) Prevalence of obesity and trends in the distribution of body mass index among US adults, 1999-2010. JAMA 307(5): 491-497. |
| [4] | Ogden CL, Carroll MD, Kit BK, et al. (2012) Prevalence of obesity and trends in body mass index among US children and adolescents, 1999-2010. JAMA 307(5): 483-490. |
| [5] | Mei Z, Scanlon KS, Grummer-Strawn LM, et al. (1998) Increasing prevalence of overweight among US low-income preschool children: the Centers for Disease Control and Prevention pediatric nutrition surveillance, 1983 to 1995. Pediatr 101(1): E12. |
| [6] | Mokdad AH, Serdula MK, Dietz WH, et al. (2000) The continuing epidemic of obesity in the United States. JAMA 284(13): 1650-1651. |
| [7] | Webber LS, Cresanta JL, Croft JB, et al. (1986) Transitions of cardiovascular risk from adolescence to young adulthood—the Bogalusa Heart Study: II. Alterations in anthropometric blood pressure and serum lipoprotein variables. J Chron Dis 39(2): 91-103. |
| [8] | Serdula MK, Ivery D, Coates RJ, et al. (1993) Do obese children become obese adults? A review of the literature. Prev Med 22(2): 167-177. |
| [9] | Guo SS, Roche AF, Chumlea WC, et al. (1994) The predictive value of childhood body mass index values for overweight at age 35 y. Am J Clin Nutr 59(4): 810-819. |
| [10] | Calle EE, Rodriguez C, Walker-Thurmond K, et al. (2003) Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U. S. adults. N Engl J Med 348(17): 1625-1638. |
| [11] | Shike M. (1996) Body weight and colon cancer. Am J Clin Nutr 63(3 Suppl): 442S-444S. |
| [12] | Murphy TK, Calle EE, Rodriguez C, et al. (2000) Body mass index and colon cancer mortality in a large prospective study. Am J Epidemiol 152(9): 847-854. |
| [13] | Bungum T, Satterwhite M, Jackson AW, et al. (2003) The relationship of body mass index, medical costs, and job absenteeism. Am J Health Behav 27(4): 456-462. |
| [14] | Fontaine KR, Redden DT, Wang C, et al. (2003) Years of life lost due to obesity. JAMA 289(2):187-193. |
| [15] | Ford ES, Moriarty DG, Zack MM, et al. (2001) Self-reported body mass index and health-related quality of life: findings from the Behavioral Risk Factor Surveillance System. Obes Res 9(1):21-31. |
| [16] | Sturm R, Ringel JS, Andreyeva T. (2004) Increasing obesity rates and disability trends. Health Aff (Millwood) 23(2): 199-205. |
| [17] | Burton WN, Chen CY, Schultz AB, et al. (1999) The costs of body mass index levels in an employed population. Stat Bull Metrop Insur Co. 80(3): 8-14. |
| [18] | Cawley J, Meyerhoefer C. (2012) The medical care cost of obesity: an instrumental variables approach. J Health Econ 31(1): 219-230. |
| [19] | Wojcicki JM, Heyman MB. (2012) Reducing childhood obesity by eliminating 100% fruit juice. Am J Public Health 102(9): 1630-1633. |
| [20] | Santos FL, Esteves SS, da Costa Pereira A, et al. (2012) Systematic review and meta-analysis of clinical trials of the effects of low carbohydrate diets on cardiovascular risk factors. Obes Rev 13(11): 1048-1066. |
| [21] | Wycherley TP, Moran LJ, Clifton PM, et al. (2012) Effects of energy-restricted high-protein, low-fat compared with standard-protein, low-fat diets: a meta-analysis of randomized controlled trials. Am J Clin Nutr 96(6): 1281-1298. |
| [22] | 25. Lustig R. Fat Chance. (2012) Beating the odds against sugar, processed food, obesity, and disease. New York: Hudson Street Press. |
| [23] | 26. Medical College of Wisconsin. Elimination of Juice/Empty Calories. (2013) Available from: http://www. mcw. edu/NDTN/Overweight/DietInterventions/EliminationofJuiceEmptyCalories. ht m. (Accessed on April 26, |
| [24] | 27. O'Neil C, Nicklas T. (2008) A Review of the Relationship between 100% Fruit Juice Consumption and Weight in Children and Adolescents. Am J Lifestyle Med 2(4): 315-354. |
| [25] | 28. Dharmasena S, Capps O, Jr. (2012) Intended and unintended consequences of a proposed national tax on sugar-sweetened beverages to combat the U. S. obesity problem. Health economics 21(6): 669-694. |
| [26] | 29. Fletcher JM, Frisvold DE, Tefft N. (2011) Are soft drink taxes an effective mechanism for reducing obesity? J Policy Anal Manage 30(3): 655-662. |
| [27] | 33. Bray GA. (2013) Energy and fructose from beverages sweetened with sugar or high-fructose corn syrup pose a health risk for some people. Adv Nutr 4(2): 220-225. |
| [28] | 34. Lustig R. (2013) Fructose: It's "Alcohol without the Buzz". Adv Nutr 4(2): 226-235. |
| [29] | 35. Rippe J, Angelopoulos T. (2013) Sucrose, high-fructose corn syrup, and fructose, their metabolism and potential health effects: what do we really know? Adv Nutr 4(2): 236-245. |
| [30] | 36. White J. (2013) Challenging the fructose hypothesis: New perspectives on fructose consumption and metabolism. Adv Nutr 4(2): 246-256. |
| [31] | 37. Klurfeld D. (2013) What do government agencies consider in the debate over added sugars? Adv Nutr 4(2): 257-261. |
| [32] | 38. Gillespie D. (2008) Sweet poison: Why sugar is making us fat. Melbourne: Viking Australia. |
| [33] | 39. Max Rubner——1854-1932. (1965) Energy physiologist. JAMA 194(1): 86-87. |
| [34] | 40. von Noorden C. (2013) Clinical Treatises on the Pathology and Therapy of Disorders (Vol. 1). Charleston: Nabu Press. |
| [35] | 41. Sievenpiper J, de Souza R, Mirrahimi A, et al. (2012) Effect of fructose on body weight in controlled feeding trials: a systematic review and meta-analysis. Ann Intern Med 156(4):291-304. |
| [36] | 42. Ha V, Sievenpiper JL, de Souza RJ, et al. (2012) Effect of fructose on blood pressure: a systematic review and meta-analysis of controlled feeding trials. Hypertension 59(4): 787-795. |
| [37] | 43. Sievenpiper JL, Carleton AJ, Chatha S, et al. (2009) Heterogeneous effects of fructose on blood lipids in individuals with type 2 diabetes: systematic review and meta-analysis of experimental trials in humans. Diabetes Care 32(10): 1930-19 |
| [38] | 44. Cozma AI, Sievenpiper JL, de Souza RJ, et al. (2012) Effect of fructose on glycemic control in diabetes: a systematic review and meta-analysis of controlled feeding trials. Diabetes Care 35(7):1611-1620. |
| [39] | 45. Sievenpiper JL, Chiavaroli L, de Souza RJ, et al. (2012) 'Catalytic' doses of fructose may benefit glycaemic control without harming cardiometabolic risk factors: a small meta-analysis of randomised controlled feeding trials. Br J Nutr 108(3): 418-423. |
| [40] | 49. Krebs-Smith SM, Guenther PM, Subar AF, et al. (2010) Americans do not meet federal dietary recommendations. J Nutr 110): 1832-1838. |
| [41] | 50. Freeland-Graves J, Nitzke S. (2013) Position of the Academy of Nutrition and Dietetics: Total diet approach to healthy eating. J Acad Nutr Diet 113(2): 307-317. |
| [42] | 53. Nitzke S, Freeland-Graves J. (2007) Position of the American Dietetic Association: Total diet approach to communicating food and nutrition information. J Am Diet Assoc 107: 7. |
| [43] | 54. Briefel RR, Wilson A, Cabili C, et al. (2013) Reducing calories and added sugars by improving children's beverage choices. J Acad Nutr Diet 113(2): 269-275. |
| [44] | 55. Barclay AW, Brand-Miller J. (2011) The Australian paradox: a substantial decline in sugars intake over the same timeframe that overweight and obesity have increased. Nutrients 3(4):491-504. |
| [45] | 56. Welch J, Sharma A, Grellinger L, et al. (2011) Consumption of added sugars is decreasing in the United States. Am J Clin Nutr 94(3): 726-734. |
| [46] |
57. Sylvetsky A, Welsh J, Brown R, et al. (2012) Low-calorie sweetener consumption is increasing in the United States. Am J Clin Nutr 96: 640-6 doi: 10.3945/ajcn.112.034751
|
| [47] | 59. Ford E, Dietz W. (2013) Trends in energy intake among adults in the United States: findings from NHANES. Am J Clin Nutr 97(4): 848-853. |
| [48] | 60. Malik VS, Schulze MB, Hu FB. (2006) Intake of sugar-sweetened beverages and weight gain: a systematic review. Am J Clin Nutr 84(2): 274-288. |
| [49] | 61. Vartanian LR, Schwartz MB, Brownell KD. (2007) Effects of soft drink consumption on nutrition and health: a systematic review and meta-analysis. Am J Public Health 97(4): 667-675. |
| [50] | 62. Olsen NJ, Heitmann BL. (2009) Intake of calorically sweetened beverages and obesity. Obes Rev10(1): 68-75. |
| [51] | 63. Wolff E, Dansinger ML. (2008) Soft drinks and weight gain: how strong is the link? Medscape J Med 10(8): 189. |
| [52] | 64. Malik VS, Popkin BM, Bray GA, et al. (2010) Sugar-sweetened beverages, obesity, type 2 diabetes mellitus, and cardiovascular disease risk. Circulation 121(11): 1356-1364. |
| [53] | 65. van Dam R, Seidell J. (2007) Carbohydrate intake and obesity. Europ J Clin Nutr 61(Suppl 1):S75-S99. |
| [54] | 66. Woodward-Lopez G, Kao J, Ritchie L. (2010) To what extent have sweetened beverages contributed to the obesity epidemic? Public Health Nutr 14(3): 499-509. |
| [55] |
67. Te Morenga l, Mallard S, Mann J. (2012) Dietary sugars and body weight: systematic review and meta-analyses of randomised controlled trials and cohort studies. Br Med J 346: e7492. doi: 10.1136/bmj.e7492
|
| [56] | 68. Pereira MA, Jacobs DR, Jr. (2008) Sugar-sweetened beverages, weight gain and nutritional epidemiological study design. Br J Nutr 99(6): 1169-1170. |
| [57] | 69. Bachman CM, Baranowski T, Nicklas TA. (2006) Is there an association between sweetened beverages and adiposity? Nutr Rev 64(4): 153-174. |
| [58] | 70. Gibson S. (2008) Sugar-sweetened soft drinks and obesity: a systematic review of the evidence from observational studies and interventions. Nutr Res Rev 21(2): 134-147. |
| [59] | 71. Mattes RD, Shikany JM, Kaiser KA, et al. (2011) Nutritively sweetened beverage consumption and body weight: a systematic review and meta-analysis of randomized experiments. Obes Rev12(5): 346-365. |
| [60] | 72. Libuda L, Kersting M. (2006) Soft drinks and body weight development in childhood: is there a relationship? Curr Opin Clin Nutr Metab Care 12(6): 596-. |
| [61] | 73. Van Baak M, Astrup A. (2009) Consumption of sugars and body weight. Obes Rev 10(Suppl 1):9-23. |
| [62] |
74. Monasta L, Batty G, Cattaneo A, et al. (2010) Early-life determinanats of overweight and obesity: a review of systematic reviews. Obes Rev 11: 695-708. doi: 10.1111/j.1467-789X.2010.00735.x
|
| [63] | 75. Forshee RA, Anderson PA, Storey ML. (2008) Sugar-sweetened beverages and body mass index in children and adolescents: a meta-analysis. Am J Clin Nutr 87(6): 1662-1671. |
| [64] | 76. Ruxton CH, Gardner EJ, McNulty HM. (2010) Is sugar consumption detrimental to health? A review of the evidence 1995-2006. |
| [65] | 77. Janssen I, Katmarzyk PT, Boyce WF, et al. (2005) Health behaviour in school-aged children obesity working group: Comparison of overweight and obesity prevalence in school-aged youth from 34 countries and their relationships with physical activity and dietary patterns. Obes Rev6(2): 123-132. |
| [66] | 78. Weed DL, Althuis MD, Mink PJ. (2011) Quality of reviews on sugar-sweetened beverages and health outcomes: a systematic review. Am J Clin Nutr 94(5): 1340-1347. |
| [67] | 79. Cope MB, Allison DB. (2010) White hat bias: examples of its presence in obesity research and a call for renewed commitment to faithfulness in research reporting. Int J Obes (Lond) 34(1):84-88. |
| [68] | 80. James J, Thomas P, Cavan D, et al. (2004) Preventing childhood obesity by reducing consumption of carbonated drinks: cluster randomised controlled trial. Br Med J 328(7450):1237. |
| [69] | 81. Ebbeling CB, Feldman HA, Osganian SK, et al. (2006) Effects of decreasing sugar-sweetened beverage consumption on body weight in adolescents: a randomized, controlled pilot study. Pediatrics 117(3): 673-680. |
| [70] | 82. Nicklas T, O'Neil C, Liu Y. (2011) Intake of added sugars is not associated with weight measures in children 6-18 years of age: NHANES 2003-2006. Nutr Res 31(5): 338-346. |
| [71] | 83. Storey ML, Forshee RA, Weaver AR, et al. (2003) Demographic and lifestyle factors associated with body mass index among children and adolescents. Int J Food Sci Nutr 54(6): 491-503. |
| [72] | 84. Marriott BP, Olsho L, Hadden L, et al. (2010) Intake of added sugars and selected nutrients in the United States, National Health and Nutrition Examination Survey (NHANES) 2003-2006. Crit Rev Food Sci Nutr 50(3): 228-258. |
| [73] | 85. Fisher JO, Mitchell DC, Smiciklas-Wright H, et al. (2001) Maternal milk consumption predicts the tradeoff between milk and soft drinks in young girls' diets. J Nutr 131(2): 246-250. |
| [74] | 86. Harnack L, Stang J, Story M. (1999) Soft drink consumption among US children and adolescents: nutritional consequences. J Am Diet Assoc 99(4): 436-441. |
| [75] | 87. Anderson GH, Luhovyy B, Akhavan T, et al. (2011) Milk proteins in the regulation of body weight, satiety, food intake and glycemia. Nestle Nutr Workshop Ser Pediatr Program 67:147-159. |
| [76] | 88. Barba G, Russo P. (2006) Dairy foods, dietary calcium and obesity: a short review of the evidence. Nutr Metab Cardiovasc Dis 16(6): 445-451. |
| [77] | 89. Deddo L. (2007) Connecting the dots. Aeon Publishing Inc. Available from: http://www. amazon. com/Connecting-The-Dots-Leonard-Deddo/dp/1595266941/ref=sr_1_1?ie= UTF8&qid=1364933001&sr=8-1&keywords=Connecting+the+Dots+leonard+deddo. (Accessed on April 2, 2013). |
| [78] | 90. Darmon N, Drewnowski A. (2008) Does social class predict diet quality? Am J Clin Nutr 87(5):1107-1117. |
| [79] | 91. Monsivais P, Drewnowski A. (2009) Lower-energy-density diets are associated with higher monetary costs per kilocalorie and are consumed by women of higher socioeconomic status. J Am Diet Assoc 109(5): 814-822. |
| [80] | 92. Brownell KD, Farley T, Willett WC, et al. (2009) The public health and economic benefits of taxing sugar-sweetened beverages. N Engl J Med 361(16): 1599-1605. |
| [81] | 93. Brownell KD, Frieden TR. (2009) Ounces of prevention—the public policy case for taxes on sugared beverages. N Engl J Med 360(18): 1805-1808. |
| [82] | 94. Fletcher J, Frisvold D, Tefft N. (2010) Can soft drink taxes reduce population weight? Contemp Econ Policy 28(1): 23-35. |
| [83] | 96. Fletcher JM, Frisvold DE, Tefft N. (2010) The effects of soft drink taxes on child and adolescent consumption and weight outcomes. J Public Econ 94(11-12): 967-974. |
| [84] | 97. Sturm R, Powell LM, Chriqui JF, et al. Deddo L. (2010) Soda Taxes, Soft Drink Consumption, And Children's Body Mass Index. Health Affairs 29(5): 1052-1058. |
| [85] | 98. Ogden CL, Kit BK, Carroll MD, et al. (2011) Consumption of sugar drinks in the United States, 2005-2008. NCHS Data Brief 71: 1-8. |
| [86] | 99. Cohen DA, Sturm R, Scott M, et al. Deddo L. (2010) Not Enough Fruit and Vegetables or Too Many Cookies, Candies, Salty Snacks, and Soft Drinks? Public Health Rep 125: 88-95. |
| [87] | 100. Reedy J, Krebs-Smith SM. Deddo L. (2010) Dietary sources of energy, solid fats, and added sugars among children and adolescents in the United States. J Am Diet Assoc 110(10):1477-1484. |
| 1. | Denis Pavăl, Ioana Valentina Micluția, The Dopamine Hypothesis of Autism Spectrum Disorder Revisited: Current Status and Future Prospects, 2021, 43, 0378-5866, 73, 10.1159/000515751 | |
| 2. | Gigi Tevzadze, Tamar Barbakadze, Elisabed Kvergelidze, Elene Zhuravliova, Lali Shanshiashvili, David Mikeladze, Gut neurotoxin p-cresol induces brain-derived neurotrophic factor secretion and increases the expression of neurofilament subunits in PC-12 cells, 2021, 9, 2373-7972, 12, 10.3934/Neuroscience.2022002 | |
| 3. | Aidan Pavao, Madeline Graham, Mario L. Arrieta-Ortiz, Selva Rupa Christinal Immanuel, Nitin S. Baliga, Lynn Bry, Reconsidering the in vivo functions of Clostridial Stickland amino acid fermentations, 2022, 76, 10759964, 102600, 10.1016/j.anaerobe.2022.102600 | |
| 4. | F. Blachier, M. Andriamihaja, Effects of the l-tyrosine-derived bacterial metabolite p-cresol on colonic and peripheral cells, 2022, 54, 0939-4451, 325, 10.1007/s00726-021-03064-x | |
| 5. | Guoqiang Liu, Quntao Yu, Bo Tan, Xiao Ke, Chen Zhang, Hao Li, Tongmei Zhang, Youming Lu, Gut dysbiosis impairs hippocampal plasticity and behaviors by remodeling serum metabolome, 2022, 14, 1949-0976, 10.1080/19490976.2022.2104089 | |
| 6. | Marina Nikolaishvili, Zakaria Nanobashvili, Nodar Mitagvaria, Gvantsa Chkadua, Tea Museliani, Gogi Jikia, Irine Bilanishvili, Khatuna Dondoladze, The Level of Individual Biochemical Constants of the Brain of in the Krushinsky-Molodkina Inbred Rat Strain against the Background of Radon Inhalation During Epilepsy, 2022, 10, 1857-9655, 2555, 10.3889/oamjms.2022.10716 | |
| 7. | Stephen I. Deutsch, Zachary N. M. Luyo, Jessica A. Burket, Targeted NMDA Receptor Interventions for Autism: Developmentally Determined Expression of GluN2B and GluN2A-Containing Receptors and Balanced Allosteric Modulatory Approaches, 2022, 12, 2218-273X, 181, 10.3390/biom12020181 | |
| 8. | Denis Pavăl, 2023, 173, 9780443137297, 1, 10.1016/bs.irn.2023.08.009 | |
| 9. | Young Hyun Jung, Chang Woo Chae, Ho Jae Han, The potential role of gut microbiota-derived metabolites as regulators of metabolic syndrome-associated mitochondrial and endolysosomal dysfunction in Alzheimer’s disease, 2024, 56, 2092-6413, 1691, 10.1038/s12276-024-01282-3 | |
| 10. | Tereena Lucas, Brent Brown, Expansion of a versatile pathogen: Clostridioides difficile, 2024, 12, 27730492, 100108, 10.1016/j.heha.2024.100108 | |
| 11. | François Blachier, 2023, Chapter 5, 978-3-031-26321-7, 189, 10.1007/978-3-031-26322-4_5 | |
| 12. | Ann B. Roskjær, Henrik M. Roager, Lars O. Dragsted, D-Amino acids from foods and gut microbiota and their effects in health and disease, 2024, 40, 8755-9129, 3196, 10.1080/87559129.2024.2347472 | |
| 13. | Mahi Basra, Lauren Miceli, Vatsala Mundra, Alison Stern-Harbutte, Hemangi Patel, Jenifer Haynes, Mayur S. Parmar, Exploring the neurotoxic effects of microbial metabolites: A potential link between p-Cresol and autism spectrum disorders?, 2024, 00068993, 149427, 10.1016/j.brainres.2024.149427 | |
| 14. | Laura Bertarini, Federico Imbeni, Antonietta Vilella, Silvia Alboni, Federica Pellati, Targeted Metabolomics for the Analysis of p-Cresol in Mouse Brain: Impact of Biological Sex and Strain, 2025, 1948-7193, 10.1021/acschemneuro.4c00698 | |
| 15. | Christina K. Flynn, James B. Adams, Rosa Krajmalnik-Brown, Alexander Khoruts, Michael J. Sadowsky, Khemlal Nirmalkar, Evelyn Takyi, Paul Whiteley, Review of Elevated Para-Cresol in Autism and Possible Impact on Symptoms, 2025, 26, 1422-0067, 1513, 10.3390/ijms26041513 | |
| 16. | Zijin Huang, Xueke Du, Fangzhou Li, Zhixuan Lan, Liang Guo, Linghui Pan, Gut microbiota and blood metabolites: unveiling their roles in hippocampal volume changes through Mendelian randomization and mediation analysis, 2025, 40, 1573-7365, 10.1007/s11011-025-01611-z | |
| 17. | Karol Chojnowski, Mikołaj Opiełka, Krzysztof Urbanowicz, Marta Zawadzka, Karolina Wangin, Ryszard Tomasz Smoleński, Maria Mazurkiewicz-Bełdzińska, Untargeted metabolomics reveals key metabolic alterations in pediatric epilepsy with insights into Tryptophan metabolism and the gut–brain axis, 2025, 15, 2045-2322, 10.1038/s41598-025-99805-z |
Theresa A. Nicklas, Carol E. O'Neil. Prevalence of Obesity: A Public Health Problem Poorly Understood[J]. AIMS Public Health, 2014, 1(2): 109-122. doi: 10.3934/publichealth.2014.2.109
| Target gene | Forward | Reverse |
| GRIN2A | TCCGCCTTTCCGATTTGGG | GCGTCCAACTTCCCAGTTTTC |
| GRIN2B | CTGAGACTGAAGAACAGGAAGATGACCATC | CGGGACTGTATTCCGCATGCAGG |
DownLoad:
CSV
