Research article Special Issues

Parallel anomaly detection algorithm for cybersecurity on the highspeed train control system


  • With the rapid development of the high-speed train industry, the high-speed train control system has now been exposed to a complicated network environment full of dangers. This paper provides a speculative parallel data detection algorithm to rapidly detect the potential threats and ensure data transmission security in the railway network. At first, the structure of the high-speed train control data received by the railway control center was analyzed and divided tentatively into small chunks to eliminate the inside dependencies. Then the traditional threat detection algorithm based on deterministic finite automaton was reformed by the speculative parallel optimization so that the inline relationship's influences that affected the data detection order could be avoided. At last, the speculative parallel detection algorithm would inspect the divided data chunks on a distributed platform. With the help of both the speculative parallel technique and the distributed platform, the detection deficiency for train control data was improved significantly. The results showed that the proposed algorithm exhibited better performance and scalability when compared with the traditional, non-parallel detection method, and massive train control data could be inspected and processed promptly. Now it has been proved by practical use that the proposed algorithm was stable and reliable. Our local train control center was able to quickly detect the anomaly and make a fast response during the train control data transmission by adopting the proposed algorithm.

    Citation: Zhoukai Wang, Xinhong Hei, Weigang Ma, Yichuan Wang, Kan Wang, Qiao Jia. Parallel anomaly detection algorithm for cybersecurity on the highspeed train control system[J]. Mathematical Biosciences and Engineering, 2022, 19(1): 287-308. doi: 10.3934/mbe.2022015

    Related Papers:

    [1] Larisa I. Fedoreyeva, Tatiana A. Dilovarova, Boris F. Vanyushin, Inna A. Chaban, Neonila V. Kononenko . Regulation of gene expression in Nicotiana tabacum seedlings by the MKASAA peptide through DNA methylation via the RdDM pathway. AIMS Biophysics, 2022, 9(2): 113-129. doi: 10.3934/biophy.2022011
    [2] Larisa I. Fedoreyeva, Boris F. Vanyushin, Ekaterina N. Baranova . Peptide AEDL alters chromatin conformation via histone binding. AIMS Biophysics, 2020, 7(1): 1-16. doi: 10.3934/biophy.2020001
    [3] Delores J. Grant, Leighcraft A. Shakes, Hope M. Wolf, Derek C. Norford, Pradeep K. Chatterjee . Exploring function of conserved non-coding DNA in its chromosomal context. AIMS Biophysics, 2015, 2(4): 773-793. doi: 10.3934/biophy.2015.4.773
    [4] Raghvendra P Singh, Guillaume Brysbaert, Marc F Lensink, Fabrizio Cleri, Ralf Blossey . Kinetic proofreading of chromatin remodeling: from gene activation to gene repression and back. AIMS Biophysics, 2015, 2(4): 398-411. doi: 10.3934/biophy.2015.4.398
    [5] Andrea Bianchi, Chiara Lanzuolo . Into the chromatin world: Role of nuclear architecture in epigenome regulation. AIMS Biophysics, 2015, 2(4): 585-612. doi: 10.3934/biophy.2015.4.585
    [6] Audrey Lejart, Gilles Salbert, Sébastien Huet . Cytosine hydroxymethylation by TET enzymes: From the control of gene expression to the regulation of DNA repair mechanisms, and back. AIMS Biophysics, 2018, 5(3): 182-193. doi: 10.3934/biophy.2018.3.182
    [7] Davood Norouzi, Ataur Katebi, Feng Cui, Victor B. Zhurkin . Topological diversity of chromatin fibers: Interplay between nucleosome repeat length, DNA linking number and the level of transcription. AIMS Biophysics, 2015, 2(4): 613-629. doi: 10.3934/biophy.2015.4.613
    [8] Yuri M. Moshkin . Chromatin—a global buffer for eukaryotic gene control. AIMS Biophysics, 2015, 2(4): 531-554. doi: 10.3934/biophy.2015.4.531
    [9] Qiao Yi Chen, Max Costa, Hong Sun . Structure and function of histone acetyltransferase MOF. AIMS Biophysics, 2015, 2(4): 555-569. doi: 10.3934/biophy.2015.4.555
    [10] Yun Chen, Bin Liu, Lei Guo, Zhong Xiong, Gang Wei . Enzyme-instructed self-assembly of peptides: Process, dynamics, nanostructures, and biomedical applications. AIMS Biophysics, 2020, 7(4): 411-428. doi: 10.3934/biophy.2020028
  • With the rapid development of the high-speed train industry, the high-speed train control system has now been exposed to a complicated network environment full of dangers. This paper provides a speculative parallel data detection algorithm to rapidly detect the potential threats and ensure data transmission security in the railway network. At first, the structure of the high-speed train control data received by the railway control center was analyzed and divided tentatively into small chunks to eliminate the inside dependencies. Then the traditional threat detection algorithm based on deterministic finite automaton was reformed by the speculative parallel optimization so that the inline relationship's influences that affected the data detection order could be avoided. At last, the speculative parallel detection algorithm would inspect the divided data chunks on a distributed platform. With the help of both the speculative parallel technique and the distributed platform, the detection deficiency for train control data was improved significantly. The results showed that the proposed algorithm exhibited better performance and scalability when compared with the traditional, non-parallel detection method, and massive train control data could be inspected and processed promptly. Now it has been proved by practical use that the proposed algorithm was stable and reliable. Our local train control center was able to quickly detect the anomaly and make a fast response during the train control data transmission by adopting the proposed algorithm.



    Fixed plants adapt to unfavorable environmental factors, often exhibiting striking phenotypic plasticity. By its nature, this plasticity is epigenetic, since a plant with the same genotype under different conditions may have different phenotypes. The term epigenetics [1] is used to describe inherited differences not caused by changes in DNA sequence, any changes in chromatin modifications, or, simply, unusual patterns of inheritance [2].

    DNA methylation and histone modifications are key mediators of epigenetic modifications. DNA methylation is usually associated with prolonged gene silencing, while histone modifications promote both activation and repression of gene transcription and can be removed after several cell cycles [3],[4]. DNA methylation in plants controls development, participates in tissue-specific gene repression and parental imprinting, and serves as a mechanism to limit the expression of multicopy genes within acceptable limits. The most important role of DNA methylation is the inactivation of potentially dangerous elements in the genome, such as transposons and foreign DNA sequences. Methylation of gene promoters usually leads to their inactivation, while demethylation leads to reactivation. DNA methylation is a covalent modification of nucleotides in DNA.

    The most well studied and most stable of all epigenetic modifications is the methylation of cytosine DNA residues [5][7]. Methylation of eukaryotic DNA is carried out by DNA enzymes methyltransferases (DMTs), which transfer the methyl group from S-adenosyl-L-methionine (SAM) to the cytosine carbon at the fifth or fourth position. Plant DNA is methylated by a vast arsenal of specific cytosine DMTs, some of which have no analogs in animals [5],[6]. These enzymes in plants, as well as in animals, are homologous to bacterial DMT and are obviously a very ancient acquisition adapted for the particular needs of multicellular organisms. These enzymes are subdivided into supporting and de novo DMT, depending on whether the recognition site is already methylated or not. There are two types of DNA supporting methyltransferases in plants: DNA methyltransferase (MET) and chromomethyltransferase (CMT) [7]. Plant genomes have three types of methylation sites CG, CNG, and CNN (where N = C, T, or A), in contrast to the single methylation site type (CG) observed in animals, with the exception of embryonic stem cells and neurons [8],[9]. Methylation of previously unmethylated DNA de novo is carried out by the DMT family, called domains rearranged methyltransferases (DRMs).

    The main cytosine DMTs in plants are MET1, CMT3, and DRM2. These enzymes methylate different DNA sites (Table 1) and have different methylation mechanisms. The DMT enzyme MET1 methylates daughter DNA strands directly during replication. It is assisted in this by three related proteins (VIM1 to VIM3) containing the SRA domain, which recognizes semimethylated CG sites in DNA [5],[6].

    The mechanism of DNA methylation by the CMT3 enzyme is based on the presence of positive links between CMT3 and the H3K9 methylation enzymes, the main one of which is SUVH4 (KRYPTONITE, KYP). It was shown that CMT3 recognizes and methylates CNG sites in chromatin loci containing H3K9me2 molecules, while KYP, in turn, methylates histone H3 molecules in CNG-methylated loci [10].

    It is known that DRMs mainly methylate asymmetrical CNN sites, but are capable of de novo methylating cytosines in any sequence context in a process called RNA-directed DNA methylation (RdDM). Interfering short RNAs (RNAi) (24 nucleotides) are formed as a result of the action of specific RNA polymerases that have been found only in plants [11].

    Asymmetric methylation (which lacks an adjacent methylcytosine to provide epigenetic information after DNA replication) is largely controlled by DMT DRM2 [12]. For normal DNA methylation by the RdDM type, an SNF2-family nucleosome remodeler (DDM1) ATP-dependent helicase is required [13],[14]. The SNF2 ATPase domain hydrolyzes ATP by moving along the chromatin DNA, thereby changing the chromatin structure, allowing other proteins to access the DNA [15]. The DDM1 mutation causes a profound loss of methylation in some transposon elements and repetitions [13],[14]. It is thought that DDM1 is involved in the methylation of CNN sites. The protein SUVR2, which has an SUVR domain, is also involved in DNA methylation by the RdDM mechanism; however, this protein does not have histone methyltransferase activity [16].

    Chromomethyltransferase CMT2, along with DMT DRM2, is responsible for methylation of CNN sites in the Arabidopsis genome [7]. On the phylogenetic tree of chromomethylases, methyltransferase CMT2 forms a separate branch. In most organs, the CMT2 gene is expressed much more weakly than CMT3.

    In recent years, interest in studying the action of short peptides has increased dramatically [17]. The secreted peptides, like phytohormones, are important in the regulation of numerous intercellular connections and physiological activities, and respond to various influences [18]. Peptides interact with signaling phytohormones and are involved in regulation with the environment, modulating a wide range of biological processes. It was found that peptides are involved in the regulation of seed development, vascular formation, and lateral root formation, and participate in stem cell homeostasis in the apical meristem of seedlings and roots [19],[20]. In plants, short peptides induce the expression of genes encoding factors of transcription, cell differentiation, growth, and development [21],[22].

    The action of exogenous peptides is gene-specific; it has a signal regulatory nature and, apparently, an epigenetic nature [18]. The molecular mechanisms of the effect of exogenous peptides on cellular processes are still not studied. One possible mechanism of action of exogenous peptides is the regulation of gene transcription.

    The aim of this study is to consider possible mechanisms of regulation of the expression of DNA methyltransferase genes in Nicotiana tabacum regenerants by short peptides AlaGluAspLeu and AlaGluAspGly.

    Tobacco seeds (N. tabacum L. cultivar Samsun) were germinated in flasks with agarose hormone-free Murashige–Skoog (MS) medium. Seeds of tobacco (Nicotiana tabacum L., Samsun serotype) were allowed to germinate in flasks with an agarized hormone-free Murashige and Skoog (MS) nutrient medium (Sigma, United States). The emerging cotyledons were detached with a scalpel and were placed on an agarized MS medium containing 10–7 M AEDL or AEDG. The control MS medium did not contain the peptides. The medium also contained phytohormones: 2 mg/L 6-benzylaminopurine, 0.2 mg/L naphtylacetic acid, and 0.2 mg/L indole-3-butyric acid. At the end of the experiment (after 21 days), the normally developed regenerated plants possessing shoots and roots were registered [23].

    DNA from tobacco regenerants was isolated using a standard method, utilizing a HigherPurity Plant DNA Purification Kit (Canvax, Spain). The purity of the preparations was determined by electrophoresis in 1% agarose. The mass of the obtained DNA was determined relative to DNA markers. RNA was isolated from regenerants of tobacco according to a standard method, using reagent kits for the isolation of RNA (Extran RNA Synthol, Russia). The concentrations of isolated DNA and RNA preparations were determined spectrophotometrically using a NanoPhotometer IMPLEN.

    cDNA was obtained by a standard method, using a set of reagents (Synthol, Russia) for reverse transcription. The concentrations of cDNA preparations were determined spectrophotometrically using a NanoPhotometer IMPLEN.

    Real-time polymerase chain reaction (PCR-RT) was carried out using a CFX 96 Real-Time System thermal cycler (BioRad, USA). Information on the primary structure of the DNA methyltransferase genes of N. tabacum was taken from the NCBI database. Primers for these genes were selected using the online service NCBI Primer-BLAST and synthesized by Syntol (Table 1). Samples were prepared by the standard method, using a set of reagents for PCR-RT in the presence of SYBR Green I (Synthol). The PCR-RT reaction was carried out under identical conditions for all samples: 95 °C for 5 min, then 45 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. The reaction was carried out in three repeats. The relative level of gene expression was calculated using a calibration curve constructed with PCR products obtained with primers for the GaPDh gene. The effectiveness of PCR-RT with primers for the studied genes reached 95–96%.

    Table 1.  Primers for PCR-RT.
    Gene 5′-3′-sequence Coding protein Function of coding protein
    MET1B GACCACTTCTTCGCCAAAGC CGTCCTGACCGATAAGTTGCT DNA (cytosine-5) methyltransferase 1B Methylate CG sites in DNA
    CMT3 TCAAGGAGAGATGGGTCTGTT AGGCAGGTCCCTGAAGTTTG DNA (cytosine-5) methyltransferase CMT3 Methylate CNG sites in DNA
    CMT2 GCTGGTCGAAAAACGAAGCG CCCACCCTTTGGTGCTTGAT DNA (cytosine-5) methyltransferase CMT2 Methylate CNN (CNG) sites in DNA
    DRM2 TGCTGGGTTTAGCCTGATGG GGAACTTGTTAGTTTCGCCCC DNA (cytosine-5) methyltransferase DRM2 Methylate de novo CNN (CNG) sites in DNA

     | Show Table
    DownLoad: CSV

    The arithmetic mean values were calculated as Mx = ΣXi/n. Standard deviations were calculated as:

    where Dх is the dispersion.

    The calculation of the main statistical parameters was carried out according to standard methods, and Statistica 10.0 for statistical data processing were used. Standard deviations are shown according to Student's criterion, p < 0.05.

    PCR amplification was performed in a thermal cycler (DNAEngine, Biorad). The PCR reaction was carried out with DNA under the same conditions as for PCR-RT with cDNA. The obtained products were analyzed by electrophoresis in 1.5% agarose.

    Digestion of genomic plant DNA (1 µg) by restriction endonuclease HpaII was performed according to a standard protocol using a Thermo Scientific Epi JET DNA Methylation Analysis Kit (Thermo Scientific).

    Fluorescence spectra were recorded using a PerkinElmer LS 55 spectrofluorometer (USA). Titration of FITC-labeled deoxyribooligonucleotides (oligos) with peptides AEDL and AEDG was carried out as described in the literature [23]. To determine the binding constants, we used the following equation:

    where Kb is a constant and n is the number of binding sites. From equations (1) and (2), it is possible to derive −log [(F0 –F)/F] = log Kb + nlog [Q] (2), where Kb and n are the constant and the number of binding sites: −Ksf = Kb[Q] n − 1 (3). For n =1, Ksf = Kb. This allows us to use the Stern–Volmer constant to evaluate the binding of peptides to various oligos [24],[25].

    Isothermal titration calorimetry was carried out using a MicroCal VP ITC instrument (MicroCal, USA) at 25 °C. The obtained data were analyzed using the Origin 7 program, using the model of ligand binding with one site type on the macromolecule (“one site” model). The obtained values of binding constant (Kb), number of binding sites (n), and excess molar enthalpy (ΔH) were used to determine the free energy of binding (ΔG) and standard entropy of binding (ΔS), as

    The size of the binding site was determined as the number of nucleotides per ligand molecule (1/n).

    Deoxyribooligonucleotides, FAM-deoxyribooligonucleotides, and peptides AEDG and AEDL were synthesized by Syntol (Russia). The equipment of the Center for Collective Use of VNIISB RAS was used in the work.

    When growing calluses of N. tabacum on a standard medium in the presence of 10−7 M peptides AEDG and AEDL, a significant increase in the mass of calluses is observed, and the total number of regenerants per explant increases. On media with tetrapeptides, the formation of large regenerants with a large leaf area was observed (Figure 1).

    Figure 1.  Regenerants of Nicotiana tabacum callus (28 days) grown without peptides (control) and in the presence of AEDL and AEDG at a concentration of 10–7 M.

    Thus, short exogenous peptides have a pronounced physiological effect on plants. The action of peptides is likely to have a regulatory character and is similar to the action of phytohormones.

    Expression of genes from N. tabacum encoding cytosine DNA methyltransferases is shown in Figure 2. In regenerants from tobacco calluses grown in the presence of AEDG and AEDL peptides, the expression level of the MET1B gene, encoding maintenance cytosine DNA methyltransferase, is activated by 30–60%. This DNA methyltransferase methylates the daughter DNA strands directly during replication.

    Figure 2.  Relative gene expression of different DNA methyltransferase. Blue: cDNA from control tobacco regenerants; orange: from regenerants grown in the presence of peptide AEDL; grey: from regenerants grown in the presence of peptide AEDG. The mean values and their standard deviations.

    DNA methyltransferase CMT3 provides downstream methylation of symmetric CNG sites. The relative level of expression of the CMT3 gene in tobacco regenerants is significantly higher than in the CMT2 and even MET1 genes. In regenerants grown in the presence of peptides, the expression of CMT3 genes increases in comparison with the control variant by approximately 25–35% (Figure 2).

    De novo methylation of previously unmethylated DNA is performed by DRM2. It is known that DRM2 mainly methylates asymmetrical CNN sites during RdDM. In regenerants from tobacco calluses grown in the presence of the AEDL peptide, the expression level of the DRM2 gene encoding the cytosine DNA methyltransferase involved in de novo DNA methylation increases insignificantly, by ≈ 20%. At the same time, the AEDG peptide almost doubles the expression of this DRM2 gene.

    Bacterial restriction endonucleases cleave DNA highly specifically at certain sites. Restrictase HpaII cleaves DNA if the DNA is not methylated at the 5′-CCGG-3′ site. We processed DNA isolated from tobacco regenerants grown both in the presence of peptides and without them with HpaII restriction enzyme (Figure 3). The enzyme weakly hydrolyzes plant DNA; to increase its capacity for restriction, we significantly increased the exposure time to 4 h. DNA restriction from tobacco regenerants grown in the presence of AEDL and AEDG peptides differs from the control in terms of both quantity and mobility.

    Figure 3.  Digestion of DNA (1µg) with a restriction enzyme HpaII. 1: DNA without peptides; 2: DNA (1) + HpaII; 3: DNA with AEDL; 4: DNA (3) + HpaII; 5: DNA with AEDG; 6: DNA (5) + HpaII.

    The decrease between the number of oligonucleotides after DNA hydrolysis from the regenerants grown in the presence of AEDL and that in the control regenerants is possibly due to the binding of the AEDL peptide to DNA at certain sites. The binding site of the AEDL peptide differs from the binding site of the AEDG peptide because the oligonucleotide sets are different, which supports the assumption that the peptides can directly bind to DNA. By binding to certain DNA sites, peptides can block their cleavage. Moreover, peptides can also block post-translational DNA methylation, thereby altering the sites of HpaII restriction enzyme cleavage.

    PCR amplification was carried out with primers for DMT genes with DNA from tobacco regenerants grown in the presence of peptides and without (Figure 4). As follows from Figure 4, the composition of the products on amplification of DNA from tobacco regenerants grown in the presence of peptides differs from that for control DNA, with all primers, except for primers for the CMT2 gene. This fact possibly indicates the binding of peptides to DNA, which leads to the appearance of new amplification products. The composition of DNA amplification products from tobacco regenerants grown in the presence of AEDG and AEDL peptides is the same; however, there are some differences in the intensity of high molecular weight oligonucleotides during PCR amplification with MET1B and DRM2 genes (Figure 4). Possibly, peptides bind to free regions of DNA and, during amplification, primers can bind to peptide-DNA motifs, and, as a result of sandwich formation during PCR amplification, nonspecific products are synthesized.

    Figure 4.  PCR amplification of DNA from tobacco regenerants with primers for the DMT genes. 1: DNA from tobacco regenerants without peptides; 2: DNA from tobacco regenerants with peptide AEDL; 3: DNA from tobacco regenerants with peptide AEDG.
    Figure 5.  Fluorescent titration of FAM-oligo with CTG site by AEDL peptide and isothermal titration oligo by AEDL peptide.
    Figure 6.  Fluorescent titration FAM-oligo with site CAG by AEDG peptide and isothermal titration oligo by AEDG peptide.

    Static quenching of FAM-oligo during oligo–peptide complex formation can be described by the Stern–Volmer equation [24],[25]. It was found that although the peptides are close in amino acid sequence and differ only in one amino acid, the AEDG peptide predominantly binds to the oligo, which includes the CAG site, and the AEDL peptide predominantly binds to the CTG site.

    As an example, Figure 5 shows graphs of the fluorescence quenching of olig FAM-CCCCCCCCCCTGCCCCCCCCC with the AEDL peptide and ITC titration of its analog without a fluorescent probe, and Figure 6 shows graphs of the fluorescence quenching of FAM-CCCCCCCCCCАGCCCCCCCCC with the AEDG peptide and ITC titration of its analog without a fluorescent probe. On the basis of these graphs, the interaction constants were calculated, which characterize the interaction of the studied peptides with oligos, as well as the molar ratio of peptide: oligo. Peptides AEDG and AEDL bind to oligos in a 1 M: 1 M ratio. However, their binding constants differ significantly from each other. This is probably because their hydrophobicity indexes differ significantly. The AEDG peptide on the Kyte–Doolittle scale is more hydrophilic (−5.6) than the AEDL (−1.4) peptide [26]. In addition, oligo binding is probably sterically hindered by the long hydrophobic end of leucine in the AEDL peptide.

    Methylation of cytosine at the CNG site leads to a decrease in the binding constant for both peptides, especially in the case of the AEDG peptide (Table 2). This is probably because cytosine methylation results in inaccessibility of the CNG site for peptide binding. Fusion of complementary oligos containing and not containing 5-methylcytosine leads to a decrease in the binding constant in the case of AEDG. Therefore, the AEDG peptide prefers to bind to single-stranded unmethylated oligos at the CAG site. Unlike the AEDG peptide, the AEDL peptide prefers to bind to double-stranded unmethylated oligos with the CTG site.

    Table 2.  Binding constants of peptides AEDG and AEDL with oligos.(revise).
    Oligos K, M
    AEDG FAM-CCC CCC CCC CCC CCC CCC CCC CCC 1.1 × 10−4
    FAM-CCC CCC CCC CAG CCC CCC CCC CCC 2.0 × 10−7
    FAM-CGC GCG CGC GCG CGC GCG CGC GCG 0.9 × 10−4
    FAM-CGC GCG CGC CAG CGC GCG CGC GCG 2.1 × 10−7
    FAM-CGC GCG CGC CAG CGC GCG CGC GCG-CGC GCG CGC GCG CTG GCG CGC GCG 8.9 × 10−5
    FAM-CGC GCG CGC meCAG CGC GCG CGC GCG 5.7 × 10−5
    FAM-CGC GCG CGC meCAG CGC GCG CGC GCG-CGC GCG CGC GCG CTG GCG CGC GCG 1.3 × 10−5
    AEDL FAM-CCC CCC CCC CCC CCC CCC CCC CCC 1.0 × 10−4
    FAM-CCC CCC CCC CTG CCC CCC CCC CCC 0.8 × 10−7
    FAM-CGC GCG CGC GCG CGC GCG CGC GCG 1.2 × 10−4
    FAM-CGC GCG CGC CTG CGC GCG CGC GCG 1.2 × 10−7
    FAM-CGC GCG CGC CTG CGC GCG CGC GCG-CGC GCG CGC GCG CAG GCG CGC GCG 1.7 × 10−7
    FAM-CGC GCG CGC meCTG CGC GCG CGC GCG 5.3 × 10−5
    FAM-CGC GCG CGC meCTG CGC GCG CGC GCG-CGC GCG CGC GCG CAG GCG CGC GCG 5.4 × 10−5

     | Show Table
    DownLoad: CSV

    The effect of peptides AEDG and AEDL on the growth of tobacco calluses at low concentrations (10−7 M) is similar to the effect of phytohormones, has a regulatory character, and is possibly epigenetic in nature. The most studied of all epigenetic modifications is the methylation of cytosine DNA residues [5],[6].

    The mechanisms of gene expression regulation by DNA methylation are poorly understood. It was assumed that the selection of methylation targets is a passive process. However, the discovery of the effect of methylated individual CG sites in the promoter region of rRNA genes in plants on the specific binding of nuclear proteins to the promoter region shows that the methylation process is an active mechanism for regulating the transcription of these genes, and not a passive result of the absence of their transcription [27].

    Comparison of the relative expression levels of genes encoding cytosine DNA methyltransferases from N. tabacum regenerants grown in the presence and absence of AEDG and AEDL peptides revealed the activation of these genes in the presence of peptides, as compared with the control (Figure 2).

    In tobacco regenerants grown in the presence of AEDG and AEDL peptides, the level of gene expression of all cytosine DMTs is activated. While the expression of the methyltransferase genes MET1 and CMT3 increases insignificantly, the expression of the CMT2 gene increases 2–3 times, and the expression of the DRM2 gene doubles in regenerants grown in the presence of AEDG. It should be noted that in regenerants grown in the presence of the AEDG peptide, the level of expression of all DMTs is higher than in regenerants grown in the presence of the AEDL peptide.

    Although the peptides differ from each other by only one amino acid, they significantly differ in binding constants and have different binding sites: the AEDG peptide predominantly binds to the CAG site, and the AEDL peptide predominantly binds to the CTG site. The CAG and CTG sites are methylation sites for the cytosine methyltransferase CMT3, and in some cases also CMT2 and DRM2.

    The composition of the products of the amplification of DNA from tobacco regenerants grown in the presence of peptides differs from those of the control DNA, with all primers, except for the primers for the CMT2 gene, which may indicate the binding of peptides to DNA, which leads to the appearance of new amplification products. The composition of DNA amplification products from tobacco regenerants grown in the presence of AEDG and AEDL peptides is the same; however, there are some differences in the intensity of high molecular weight oligonucleotides during PCR amplification with MET1B and DRM2 genes (Figure 4).

    The set of oligonucleotides obtained after DNA restriction from regenerants grown in the presence of AEDL differs from DNA restriction from control tobacco regenerants, as well as regenerants grown in the presence of AEDG, in both quantity and mobility.

    The decrease in the number of oligonucleotides after DNA hydrolysis from the regenerants grown in the presence of AEDL, compared with the control, is possibly due to the binding of the AEDL peptide to DNA at certain sites. The binding site of the AEDL peptide differs from the binding site of the AEDG peptide, since the sets of oligonucleotides differ from each other. These data support the assumption that peptides can directly bind to DNA. By binding to sites, peptides can block their cleavage. Moreover, peptides can also block post-translational DNA methylation, thereby altering the sites of HpaII restriction enzyme cleavage.

    The DMTs are encoded in the genome and it is logical to assume that their activity is also regulated by DNA methylation. In this case, a drop in the level of DNA methylation, which is caused by peptide binding to sites involved in the methylation process, should lead to increased expression of DMT genes and, as a consequence, to a compensatory increase in the activity of methylation systems. Thus, an increase in the activity of the expression of DMT genes in tobacco regenerants is because short peptides bind to CNG sites, blocking methylation sites, thereby reducing the level of DNA methylation.

    Titration of synthetic oligos with peptides revealed that although the peptides are close in amino acid sequence and differ only in one amino acid, they bind to different sites and have different binding constants. The AEDG peptide preferentially binds to the oligos, which includes the CAG site, and the AEDL peptide binds to the CTG site. This selective binding of structurally related peptides is explained by their different hydrophobicity and steric effects.

    The specific binding of peptides to single-stranded oligos that we have discovered may be of particular importance. Single-stranded regions always exist or appear in DNA; for example, they arise during replication, recombination, and repair of the genome. The interaction of short peptides with such regions can control these genetic processes in a targeted manner. In addition, intercalation of short peptides into DNA is accompanied by local untwisting of DNA strands [28], which leads to the emergence of single-stranded targets for binding of peptides to DNA. This takes on a special meaning in the event of the possible combined action of different peptides in the cell, when some serve as inducers of the emergence of single-stranded structures in the genome, while others, as a result, are actually initiator regulatory agents of the biological effect.

    The regulation of DNA methylation can occur by different mechanisms, since many players are involved in this process, but, first of all, regulation is carried out through the expression of genes of DNA methyltransferases. Controlling the regulation of DMT genes is of particular importance, since the process of DNA methylation in plants controls most of the processes occurring in plants. Methylation of gene promoters usually leads to their inactivation, while demethylation leads to reactivation.

    It has been shown that short peptides are able to regulate the expression of DMT genes. One possible mechanism for the regulation of DMT genes by short peptides is their ability to bind to free DNA regions at certain CNG sites, which are also methylation sites of plant cytosine methyltransferases. By binding to the same sites as DNA methyltransferases, peptides block methylation sites, thereby reducing the level of DNA methylation, and causing an increase in the expression of DMT genes, especially CMT2 and DRM2. The AEDG peptide has higher oligo binding constants than the AEDL peptide. This fact probably explains the higher expression of DMT genes by AEDG.

    The specific binding of peptides to different sites that we have discovered can be of great importance in the regulation of DMT genes, and not only these genes, since the use of peptides with different structures can block different DNA regions for methylation of certain genes, thereby activating or silencing their expression.



    [1] Y. Chen, Non-safety-related software in the context of railway RAMS standards, in 2017 IEEE Second International Conference on Reliability Systems Engineering (ICRSE), (2017), 1-5. doi: 10.1109/ICRSE.2017.8030718.
    [2] T. Wang, Y. Quan, X. Shen, T. R. Gadekallu, W. Wang, K. Dev, A Privacy-Enhanced Retrieval Technology for the Cloud-assisted Internet of Things, IEEE Trans. Ind. Inf., 2021. doi: 10.1109/TⅡ.2021.3103547. doi: 10.1109/TⅡ.2021.3103547
    [3] C. Feng, K. Yu, M. Aloqaily, M. Alazab, Z. Lv, S. Mumtaz, Attribute-based encryption with parallel outsourced decryption for edge intelligent IoV, IEEE Trans. Veh. Technol., 69 (2020), 13784-13795. doi: 10.1109/TVT.2020.3027568. doi: 10.1109/TVT.2020.3027568
    [4] C. Feng, B. Liu, Z. Guo, K. Yu, Z. Qin, K. R. Choo, Blockchain-based Cross-domain Authentication for Intelligent 5G-enabled Internet of Drones, IEEE Internet Things J., 2021. doi: 10.1109/JIOT.2021.3113321. doi: 10.1109/JIOT.2021.3113321
    [5] L. Tan, K. Yu, F. Ming, X. Chen, G. Srivastara, Secure and resilient Artificial Intelligence of Things: a HoneyNet approach for threat detection and situational awareness, IEEE Consum. Electron. Mag., 2021. doi: 10.1109/MCE.2021.3081874. doi: 10.1109/MCE.2021.3081874
    [6] K. Yu, Z. Guo, Y. Shen, W. Wang, J. C. Lin, T. Sato, Secure artificial intelligence of things for implicit group recommendations, IEEE Internet Things J., 2021. doi: 10.1109/JIOT.2021.3079574. doi: 10.1109/JIOT.2021.3079574
    [7] A. Aghdai, C. Chu, Y. Xu, D. Dai, J. Xu, J. Chao, Spotlight: Scalable transport layer load balancing for data center networks, IEEE Trans. Cloud Comput., 8 (2020), 1471-1485. doi: 10.1109/tcc.2020.3024834. doi: 10.1109/tcc.2020.3024834
    [8] K. Yu, M. Arifuzzaman, Z. Wen, D. Zhang, T. Sato, A key management scheme for secure communications of information centric advanced metering infrastructure in smart grid, IEEE Trans. Instrum. Meas., 64 (2015), 2072-2085. doi: 10.1109/TIM.2015.2444238. doi: 10.1109/TIM.2015.2444238
    [9] L. Zhang, M. Peng, W. Wang, Z. Jin, Y. Su, H. Chen, Secure and efficient data storage and sharing scheme for blockchain-based mobile-edge computing, Trans. Emerging Telecommun. Technol., (2021), 4315. doi: 10.1002/ett.4315. doi: 10.1002/ett.4315
    [10] W. Wang, H. Xu, M. Alazab, T. R. Gadekallu, Z. Han, C. Su, Blockchain-based reliable and efficient certificateless signature for ⅡoT devices, IEEE Trans. Ind. Inf., 2021. doi: 10.1109/tii.2021.3084753. doi: 10.1109/tii.2021.3084753
    [11] L. Tan, K. Yu, N. Shi, C. Yang, W. Wei, H. Lu, Towards secure and privacy-preserving data sharing for covid-19 medical records: A blockchain-empowered approach, IEEE Trans. Network Sci. Eng., 2021. doi: 10.1109/TNSE.2021.3101842. doi: 10.1109/TNSE.2021.3101842
    [12] H. Xiong, C. Jin, M. Alazab, K. Yeh, H. Wang, T. R. Gadekallu, et al., On the design of blockchain-based ECDSA with fault-tolerant batch verication protocol for blockchain-enabled IoMT, IEEE J. Biomed. Health Inf., 2021. doi: 10.1109/JBHI.2021.3112693. doi: 10.1109/JBHI.2021.3112693
    [13] J. Song, Z. Han, W. Wang, J. Chen, Y. Liu, A new secure arrangement for privacy-preserving data collection, Comput. Stand. Interfaces, (2021), 103582. doi: 10.1016/j.csi.2021.103582. doi: 10.1016/j.csi.2021.103582
    [14] Z. Liu, A. K. Nath, X. Ding, H. Fu, M. Khan, W. Yu, Multivariate modeling and two-level scheduling of analytic queries, Parallel Comput., 85 (2019), 66-78. doi: 10.1016/j.parco.2019.01.006. doi: 10.1016/j.parco.2019.01.006
    [15] K. Yu, L. Tan, L. Lin, X. Cheng, Z. Yi, T. Sato, Deep-learning-empowered breast cancer auxiliary diagnosis for 5GB remote E-health, IEEE Wireless Commun., 28 (2021), 54-61. doi: 10.1109/MWC.001.2000374. doi: 10.1109/MWC.001.2000374
    [16] W. Wu, S. Xu, Intrusion detection based on dynamic gemini population DE-K-mediods clustering on hadoop platform, Int. J. Pattern Recognit. Artif. Intell., 35 (2021), 2150001. doi: 10.1142/S0218001421500014. doi: 10.1142/S0218001421500014
    [17] Y. Gong, L. Zhang, R. Liu, K. Yu, G. Srivastava, Nonlinear MIMO for industrial Internet of Things in cyber-physical systems, IEEE Trans. Ind. Inf., 17 (2020), 5533-5541. doi: 10.1109/TⅡ.2020.3024631. doi: 10.1109/TⅡ.2020.3024631
    [18] Y. Song, Y. Wen, D. Zhang, J. Zhang, Fast prediction model of coupling coefficient between pantograph arcing and GSM-R antenna, IEEE Trans. Veh. Technol., 69 (2020), 11612-11618. doi: 10.1109/TVT.2020.3015057. doi: 10.1109/TVT.2020.3015057
    [19] N. M. Balamurugan, S. Mohan, M. Adimoolam, A. John, T. R. Gadekallu, W. Wang, DOA tracking for seamless connectivity in beamformed IoT-based drones, Comput. Stand. Interfaces, 79 (2022), 103564. doi: 10.1016/j.csi.2021.103564. doi: 10.1016/j.csi.2021.103564
    [20] F. Z. Beana, N. Benamrane, M. A. Hamaida, A. M. Chaabani, A. T. Ahmed, Network Intrusion Detection System using neural network and condensed nearest neighbors with selection of NSL-KDD influencing features, in 2020 IEEE International Conf. Internet Things Intell. Syst.(IoTaIS), Bali, (2021), 23-29. doi: 10.1109/IoTaIS50849.2021.9359689.
    [21] M. D. Mauro, G. Galatro, A. Liotta, Experimental review of neural-based approaches for network intrusion management, IEEE Trans. Network Serv. Manage., 2020. doi: 10.1109/TNSM.2020.3024225. doi: 10.1109/TNSM.2020.3024225
    [22] M. Injadat, A. Moubayed, A. B. Nassif, A. Shami, Multi-stage optimized machine learning framework for network intrusion detection, IEEE Trans. Network Serv. Manage., 2020. doi: 10.1109/TNSM.2020.3014929. doi: 10.1109/TNSM.2020.3014929
    [23] Z. Guo, K. Yu, A. Jolfaei, A. K. Bashir, A. O. Almagrabi, N. Kumar, A fuzzy detection system for rumors through explainable adaptive learning, IEEE Trans. Fuzzy Syst., 2021. doi: 10.1109/TFUZZ.2021.3052109. doi: 10.1109/TFUZZ.2021.3052109
    [24] Z. Guo, K. Yu, Y. Li, G. Srivastava, J. C. Lin, Deep learning-embedded social internet of things for ambiguity-aware social recommendations, IEEE Trans. Network Sci. Eng., 2021. doi: 10.1109/TNSE.2021.3049262. doi: 10.1109/TNSE.2021.3049262
    [25] L. Ding, K. Huang, D. Zhang, Multi-stride regular expression matching using parallel character index, J. Comput. Res. Dev., 52 (2015), 681-690. doi: 10.7544/issn1000-1239.2015.20131255. doi: 10.7544/issn1000-1239.2015.20131255
    [26] S. Lu, Z. Zuo, L. Wang, Progress in parallelization of static program analysis, J. Software, 31 (2020), 1241-1254. doi: 10.13328/j.cnki.jos.005950. doi: 10.13328/j.cnki.jos.005950
    [27] R. Yang, C. Hu, X. Sun, P. Garraghan, T. Wo, Z. Wen, et al., Performance-aware speculative resource oversubscription for large-scale clusters, IEEE Trans. Parallel Distrib. Syst., 31 (2020), 1499-1571. doi: 10.1109/TPDS.2020.2970013. doi: 10.1109/TPDS.2020.2970013
    [28] H. Dong, H. Zhu, Y. Li, Y. Lv, S. Gao, Q. Zhang, et al., Parallel intelligent systems for integrated high-speed railway operation control and dynamic scheduling, IEEE trans. Cybern., 48 (2018), 3381-3389. doi: 10.1109/TCYB.2018.2852772. doi: 10.1109/TCYB.2018.2852772
    [29] H. Li, K. Yu, B. Liu, C. Feng, Z. Qin, G. Srivastava, An efficient ciphertext-policy weighted attribute-based encryption for the Internet of health things, IEEE J. Biomed. Health Inf., 2021. doi: 10.1109/JBHI.2021.3075995. doi: 10.1109/JBHI.2021.3075995
    [30] C. Feng, B. Liu, K. Yu, S. K. Goudos, S. Wan, Blockchain-empowered decentralized cross-domain federated learning for 5G-enabled UAVs, IEEE Trans. Ind. Inf., 2021. doi: 10.1109/TⅡ.2021.3116132. doi: 10.1109/TⅡ.2021.3116132
    [31] L. Zhen, Y. Zhang, K. Yu, N. Kumar, A. Barnawi, Y. Xie, Early collision detection for massive random access in satellite-based internet of things, IEEE Trans. Veh. Technol., 2021. doi: 10.1109/TVT.2021.3076015. doi: 10.1109/TVT.2021.3076015
    [32] W. Shang, J. Chen, H. Bi, Y. Sui, Y. Chen, H. Yu, Impacts of covid-19 pandemic on user behaviors and environmental benefits of bike sharing: A big-data analysis, Appl. Energy, 285 (2021), 116429. doi: 10.1016/j.apenergy.2020.116429. doi: 10.1016/j.apenergy.2020.116429
    [33] Y. Sun, J. Liu, K. Yu, M. Alazab, K. Lin, PMRSS: Privacy-preserving medical record searching scheme for intelligent diagnosis in IoT healthcare, IEEE Trans. Ind. Inf., 2021. doi: 10.1109/TⅡ.2021.3070544. doi: 10.1109/TⅡ.2021.3070544
    [34] L. Liu, J. Feng, Q. Pei, C. Chen, Y. Ming, B. Shang, et al., Blockchain-enabled secure data sharing scheme in mobile-edge computing: An asynchronous advantage actor-critic learning approach, IEEE Internet Things J., 8 (2020), 2342-2353. doi: 10.1109/JIOT.2020.3048345. doi: 10.1109/JIOT.2020.3048345
    [35] J. Feng, F. R. Yu, Q. Pei, X. Chu, J. Du, L. Zhu, Cooperative computation offloading and resource allocation for blockchain-enabled mobile-edge computing: A deep reinforcement learning approach, IEEE Internet Things J., 7 (2019), 6214-6228. doi: 10.1109/jiot.2019.2961707. doi: 10.1109/jiot.2019.2961707
  • This article has been cited by:

    1. Anastasiia Ilina, Vladimir Khavinson, Natalia Linkova, Mikhael Petukhov, Neuroepigenetic Mechanisms of Action of Ultrashort Peptides in Alzheimer’s Disease, 2022, 23, 1422-0067, 4259, 10.3390/ijms23084259
    2. Szymon Kamil Araj, Jakub Brzezik, Katarzyna Mądra-Gackowska, Łukasz Szeleszczuk, Overview of Epitalon—Highly Bioactive Pineal Tetrapeptide with Promising Properties, 2025, 26, 1422-0067, 2691, 10.3390/ijms26062691
  • Reader Comments
  • © 2022 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Metrics

Article views(3233) PDF downloads(105) Cited by(3)

Figures and Tables

Figures(9)  /  Tables(4)

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog