Citation: Alexandra Díez-Méndez, Raul Rivas. Improvement of saffron production using Curtobacterium herbarum as a bioinoculant under greenhouse conditions[J]. AIMS Microbiology, 2017, 3(3): 354-364. doi: 10.3934/microbiol.2017.3.354
[1] | Ananya Mukherjee, Puja Bhattacharjee, Rituparna Das, Arundhati Pal, Amal K. Paul . Endophytic bacteria with plant growth promoting abilities from Ophioglossum reticulatum L.. AIMS Microbiology, 2017, 3(3): 596-612. doi: 10.3934/microbiol.2017.3.596 |
[2] | Matthew E. Bechard, Payam Farahani, Dina Greene, Anna Pham, Andrew Orry, Madeline E. Rasche . Purification, kinetic characterization, and site-directed mutagenesis of Methanothermobacter thermautotrophicus RFAP Synthase Produced in Escherichia coli. AIMS Microbiology, 2019, 5(3): 186-204. doi: 10.3934/microbiol.2019.3.186 |
[3] | Ligozzi Marco, Galia Liliana, Bertoncelli Anna, Mazzariol Annarita . Intrinsic role of coagulase negative staphylococci norA-like efflux system in fluoroquinolones resistance. AIMS Microbiology, 2017, 3(4): 908-914. doi: 10.3934/microbiol.2017.4.908 |
[4] | Xavier Cruz-González, Nereha Laza-Pérez, Pedro F. Mateos, Raúl Rivas . Analysis and effect of the use of biofertilizers on Trifolium rubens L., a preferential attention species in Castile and Leon, Spain, with the aim of increasing the plants conservation status. AIMS Microbiology, 2017, 3(4): 733-746. doi: 10.3934/microbiol.2017.4.733 |
[5] | Natalia Y. Kovalskaya, Eleanor E. Herndon, Juli A. Foster-Frey, David M. Donovan, Rosemarie W. Hammond . Antimicrobial activity of bacteriophage derived triple fusion protein against Staphylococcus aureus. AIMS Microbiology, 2019, 5(2): 158-175. doi: 10.3934/microbiol.2019.2.158 |
[6] | José Rodrigo da-Silva, Ana Alexandre, Clarisse Brígido, Solange Oliveira . Can stress response genes be used to improve the symbiotic performance of rhizobia?. AIMS Microbiology, 2017, 3(3): 365-382. doi: 10.3934/microbiol.2017.3.365 |
[7] | Yen Thi Ngoc Phan, Minh Thuy Tang, Tu Thi Minh Tran, Van Huu Nguyen, Trang Hien Nguyen, Takeshi Tsuruta, Naoki Nishino . Diversity of lactic acid bacteria in vegetable-based and meat-based fermented foods produced in the central region of Vietnam. AIMS Microbiology, 2017, 3(1): 61-70. doi: 10.3934/microbiol.2017.1.61 |
[8] | Joseph O. Falkinham . Mycobacterium avium complex: Adherence as a way of life. AIMS Microbiology, 2018, 4(3): 428-438. doi: 10.3934/microbiol.2018.3.428 |
[9] | Lorena Carro, Imen Nouioui . Taxonomy and systematics of plant probiotic bacteria in the genomic era. AIMS Microbiology, 2017, 3(3): 383-412. doi: 10.3934/microbiol.2017.3.383 |
[10] | Allison Yaguchi, Dyllan Rives, Mark Blenner . New kids on the block: emerging oleaginous yeast of biotechnological importance. AIMS Microbiology, 2017, 3(2): 227-247. doi: 10.3934/microbiol.2017.2.227 |
The rhizosphere is a hot spot of microbial diversity where root exudates provide energy sources and nutrients, which result in an increase in the microbial population within this ecological niche [1]. Rhizosphere microorganisms can be neutral or pathogenic, whereas other microbes can establish a beneficial relationship with their host, such as those known as plant growth promoting rhizobacteria (PGPR) [2]. There are mainly two types of soil bacteria that can act as PGPR: rhizospheric bacteria, defined as the rhizospheric biota able to colonize root surfaces [3] and endophytic bacteria, defined as the bacteria that colonize plant tissues, which reside in the vascular system [5], in the intercellular space [6] or within the cells [7] without producing any negative damage to the host [4]. Both types of bacteria trigger similar mechanisms of growth stimulation [8,9]. The effects of PGPR take place through different types of processes, which are classified into two types of mechanisms: indirect or direct [10]. Indirect mechanisms refer to those processes that occur outside the plant and include improved nutrient availability, such as free nitrogen fixation [11,12,13], phosphate solubilisation activity [14], the production of an iron chelation siderophore [15], and also those processes involved in the biocontrol of microbial pathogens [16]. Direct mechanisms on the other hand, occur inside the plant and directly affect to host's metabolism, such as in the production of phytohormones (auxins, cytokinins and gibberellins) [17], and/or the reduction of abiotic stress, such as plant ethylene levels by synthesising ACC-deaminase [18].
These bacterial plant promoters are commonly present in different environments and are associated with many plant species, both wild and agricultural [9]. Examples of these types of plants include wild rice species [19], Pelargonium graveolens [20], Rhizophora mangle [21], Laguncularia mangroove [22], forest species like oak [23], and cactus species like Manillaria carnea [24]. Also, bacterial plant promoters have been described in different crops like Phaseolus vulgaris [25], Solanum tuberosum [26], Beta vulgaris [27], Zea mays [28] and oat [29]. Despite the diverse relationships that can occur between bacteria and plants, there are few data concerning agriculture species, including the saffron producing plant Crocus sativus (L.); although recently, the isolation of different rhizobacteria strains from the rhizosphere of Crocus sativus (L.), such as Pseudomonas sp, Klebsiella sp, Bacillus subtilis, Acinetobacter haemolyticus, Acinetobacter lwofii, Pantoea sp, [30] has been reported.
Saffron is comprised of the dried stigmas of Crocus sativus (L.), which belongs to the Iridaceae family, and is the most expensive spice in the world [31]. Saffron is mainly used as a flavouring agent and as a food colourant [32,33,34,35], and Iran, India and Spain are the largest producers [36] of this spice. Remarkably, saffron cultivation and collection is done solely by hand, without the use of machines, and 150 flowers are needed to produce one gram of dried stigmas. Hence, a slight increase in the size of the saffron filaments per plant would result in a significant increase in its overall production. In addition, there are only a few published reports regarding the effects of plant promoters on the production of saffron, finding data about it, after using the register biofertilizers Bacillus subtilis FZB24 [31]. Thus, the aim of this study was to evaluate the use of the endophyte Curtobacterium herbarum Cs10, isolated from wild Crocus serotinus subs clusii, as a potential bioinoculant in saffron production.
The strain Cs10 was isolated from a Crocus serotinus subs clusii bulb. The bulb was surface sterilised in a Cl2Hg (2.5%) solution for 10 minutes followed by five washes in sterilised H2O. Then, the bulb was crushed and plated on YEDP medium (Glucose 7 g/L; Bacto Yeast Extract 3 g/L; Calcium hydrogen phosphate anhydrous 3 g/L and agar 15 g/L) under sterile conditions. Some bulbs were cultured in the appropriate medium and used as negative controls. One colony was re-streaked on YEDP medium plates until a pure culture was obtained.
DNA was extracted from the pure culture using the REDExtract-n-AmpTM Plant PCR Kit (Sigma) following the manufacturer's instructions. PCR was performed using the 27F (5'AGAGTTTGATCCTGGCTCAG) and 1522R (5'AAGGAGGTGATCCNCCRCA) bacteria-specific primers under the following conditions: preheating at 95 ℃ for 9 minutes, 35 cycles of denaturation at 95 ℃ for 1 min, annealing at 54 ℃ for 1 minute and extension at 72 ℃ during 1 minute, and a final extension at 72 ℃ for 7 minutes. The PCR amplicon was run on a 1% agarose (w/v) gel and the size was checked using the GeneRuler 1 Kb DNA Ladder (Thermo ScientificTM). The DNA fragments were isolated and purified using the GeneJet Gel Extraction and DNA Cleanup Micro Kit (Thermo ScientificTM) according to the manufacturer's instructions. The fragment was sequenced at the Macrogen DNA Sequencing Service (Macrogen, Europe). The sequences of both strands were matched using a global alignment and a contig was created using the CAP contig assembly program of BioEdit ver 7.2.5. The consensus sequence was submitted to EZBiocloud at the website http://www.ezbiocloud.net.
The sequences that were the closest were selected and aligned using the multiple alignment program Muscle of MEGA7. A distance matrix was generated and a phylogenetic tree was constructed using a Neighbour-joining algorithm [37]. The reliability of the phylogenetic tree generated from the above analyses was assessed by using a bootstrap program in sets of 1000 re-samplings (MEGA 7).
Phosphate solubilisation was tested in YED-P medium [38] and iron chelation, via siderophores production, was determined by the formation of an orange-yellow halo in M9-CAS-AGAR [39]. Indole acetic acid (IAA) production was evaluated in JMM medium supplemented with 107 mg l–1 of tryptophan [40]. After 5 days of incubation at 28 ℃, the culture supernatants were recovered by centrifugation and subsequently filtered. Analysis of IAA was carried out in the Elemental Analysis, Chromatography and Mass Spectrometry Service of NUCLEUS (University of Salamanca) in an Agilent 1100 HPLC, using a trap XCT ion trap mass spectrometer as the MS/MS detector. An ascent is express C18 column 10 cm length and 2.1 mm diameter with 2.7-micron particle size was used. Eluent A was water with 0.1% formic acid and eluent B was acetonitrile. The initial conditions were 90% A and 10% B. A gradient was used to reach at 3 min. 20% of B and at 20 min. 90% of B. An IAA D2 internal standard was used in the analysis.
Crocus sativus bulbs were sown in non-sterile soil (3:1 peat:vermiculite). A total of 15 plants per treatment were used (1 plant per plot). Thirteen days post saffron sprout, a single inoculation of 50 mL of a Cs10 strain suspension (107 cells mL–1) was performed. Posts were watered weekly and no fertilisers were added. The flowers were collected each week. Plants were harvested 3 weeks after inoculation and the total number of flowers, the amount of saffron and the length of the saffron threads were determined.
Data were statistically analysed using the one-way analysis of variance (one-way ANOVA) technique. The mean values were compared using the Fisher protected LSD test (p = 0.05) and the Statview software 5.0 was used for the statistical analyses.
The use of PGPR is considered as an ecological alternative to chemical fertilisers due to their ability to enhance yield production, reduce abiotic or biotic stress and confer protection against pathogens [41]. Thus, research based on agriculture focuses mainly on the rhizosphere because this environment is rich in microbial diversity [42]. However, the isolation of endophytes has received much attention in the last few decades. In this study, bacterial isolation was carried out on 8 plants of Crocus serotinus subs claussii collected from Calvarrasa de Arriba (40° 55' 36'' N, 5° 33' 20'' O) Salamanca, Spain. As a result, the strain Cs10 was isolated from the bulbs unlike the rest of bacterial strain. This result showed that this type of bulb is not a place where bacteria normally live, which may be due to the fact that plant species belonging to the Iridaceae family synthesise different antimicrobial substances against fungi and gram-positive bacteria [43,44]. For this reason, and also for its capacity to solubilise phosphate on the isolation medium used, the strain Cs10 was selected and further analysed.
To identify bacterial species, we obtained the complete 16S rRNA sequence. The sequence was compared with those from a public database using the FASTA format [45]. It was determined that the isolate belonged to the phylum Actinobacteria, showing 99.8% similarity to the type strain of Curtobacterium herbarum (P420/07T). A neighbor-joining phylogenetic tree was generated, and the results showed that the closest bacterial species was Curtobacterium herbarum (P420/07T) (Figure 1). In order for a strain to be considered as a potential PGPR, the microorganism selected must be safe for the environment and for humans [25]. Although some strains belonging to Curtobacterium flacumfaciens are well-establish phytopathogens [46], it does not mean that all species from the genera Curtobacterium act as pathogens. Bacterial strains belonging to Curtobacterium ginsengisoli were isolated from soil in a ginseng field [47] and Curtobacterium herbarum was first isolated from the phyllosphere of non-diseased grass [48]. Moreover, the strain Cs10 was isolated from non-diseased Crocus serotinus subsp. clusii plants in this study.
To date, there is no data on native microbes isolated from Crocus sativus tissues. However, a recent study reported the isolation of different PGPR belonging to the genera Pseudomonas, Klebsiella, Bacillus, Acinetobacter and Pantoea within the Crocus sativus (L.) rhizosphere [30]; although there are no data regarding their re-inoculation in saffron plants, as well as their impact on saffron production. Despite this, other researchers have inoculated saffron plants with plant promoters isolated from other niches; an example of this is the registered biofertilizer Bacillus subtilis FZB24, which increases leaf length, the number of flowers per corm and total stigma biomass [31]. In this study, we selected Crocus serotinus subs clusii as a microbial source because it is a local plant that lives in soils. Moreover, it belongs to the Crocus genus and is catalogued as an autumn flowering as Crocus sativus [49]. In addition, both species live in environments characterised by warm dry summers and cool winters [50].
To evaluate the possible plant growth promoting effects of Cs10, we analysed different culture depend on methods as its ability to synthesise IAA, solubilization of phosphorus and its capacity to chelate siderophore, being all the results positives.
Phosphorus (P) constitutes an important soil nutrient for plant development and its presence in soil can either be from organic or inorganic compounds. The majority of P is highly insoluble and unavailable to plants [51]. Thus, phosphate solubilizing microorganisms play an important role as biofertilizers. Cs10 was able to solubilize phosphate on YEDP medium, as seen by the presence of a degradation halo around the colonies. Diverse associations among agriculture crops like wheat, tomato and radish and phosphate solubilizing bacteria have been reported [3], and this ability can enhance plant growth under certain conditions [52]. Many rhizobacteria are catalogued as microbial phosphate solubilisers such as Pseudomonas plecoglossicida (PSB-5) and Pantoea cypripedii (PSB-3) [53], different rhizobacteria [54], among others. Therefore, it seems that phosphate solubilisation is a common feature of PGPR, as well as Cs10.
Furthermore, general phytohormones, such as cytokinins, IAA and gibberellins, are produced by plant-associated bacteria and are involved in the improvement of plant growth and reproduction, and help to protect plants against biotic and abiotic factors [55]. Also, IAA is one of the most study phytohormones as it contributes to plant growth and the protection against pathogens [56]. In this study, IAA was measured by HPLC (Figure 2) and a concentration of 11.9 ng/mL was determined. IAA can stimulate plant cell elongation and/or cell proliferation, induce the synthesis of ACC-desaminase, which stimulates the production of ethylene in the plant [18]. Also, this event has been described for different bacterial strains, such as Burkholderia phytofirmans PsJN [57], Enterobacter sp. 638, Pseudomonas putida W619, Serratia proteamaculans, [58] which suggests this may be a common plant growth promoting characteristic among rhizobacteria.
Regarding the microbial siderophore, Fe is an essential micronutrient for the survival and proliferation of all plants [59]. Also, it is well known that microorganisms supply Fe to plants, and enhance the growth of the host when the bioavailability of Fe is low [60] and, also is described as an ecological alternative to hazardous pesticides [61]. The bacterial strain Cs10 was surrounded by a yellow-orange halo. Furthermore, bacterial species from the genera Pseudomonas and Streptomyces are classified as PGPR for their ability to produce siderophores [62,63].
The results obtained from the mechanisms of the PGPR suggest that theCs10 bacterial strain could be a potential candidate for enhanced saffron production.
PGPR can act as important ecological alternatives that promote plant development by direct or indirect mechanisms. To evaluate the effect of the Cs10 strain with the agronomic saffron, a greenhouse assay was performed. Saffron bulbs were sown in non-sterile soil (3:1 peat: vermiculite) and no chemicals fertilisers were added. As shown in Table 1, the plants treated with the Cs10 strain presented the best results compared with the control treatment. Moreover, we obtained a similar number of flowers in both treatments. However, Cs10 treatment exhibited a significant improvement in the length of the saffron threads (3.10 ± 0.035) and saffron yields (0.013 ± 0.001). These results must be related to the different PGPRs abilities exhibited in vitro assays by Cs10 strain. Thus, the in vitro abilities shown by Cs10 strain as well as the results already described, indicate that the results obtained in the greenhouse assay were due to a potential synergy among the effects of the PGPR. Both, direct and indirect mechanisms have been described in the literature as promoters of plant development and improved yield production. In agreement with this, our results suggest that the saffron plants treated with the strain Cs10 exhibited longer saffron threads and were heavier than the control plants. All of these improvements may well enhance spice production as there were more flowers per corm and their filaments weighed more.
Treatments | Total number of flowers | Saffron threads length (cm) ± S.E* | Saffron yield (g) ± S.E.* |
Control | 28 | 2.85 ± 0.0039a* | 0.007 ± 0.001a* |
Cs10 | 29 | 3.10 ± 0.0035b* | 0.013 ± 0.001b* |
To the best of our knowledge, this is the first study regarding the beneficial effects of Curtobacterium herbarum Cs10 on saffron production. Due to the PGPR mechanisms exhibited by strain Cs10, we believe it has a potential role as a promoter of saffron growth under greenhouse conditions. Nevertheless, field studies are required.
In conclusion, our results indicate that Curtobacterium herbarum Cs10 can interact with saffron plants and significantly improve the production of this spice. Also, we conclude that Crocus serotinus subs clusii contains endophytic bacteria that may potentially be used for enhancing saffron production.
This work was supported by grant SA169U14 from the Regional Government of Castile & Leon and by grant AGL2015-70510-R from MINECO (Spanish Ministry of Economy, Industry and Competitiveness). ADM is the recipient of a predoctoral fellowship from the Regional Government of Castile & Leon.
All authors state no conflict of interest in this paper.
[1] | Haas D, Défago G (2005) Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol 3: 307–319. |
[2] | Cázares-García SV, Arredondo-Santoyo M, Vázquez-Garcidueñas MS, et al. (2016) Typing and selection of wild strains of Trichoderma spp. producers of extracellular laccase. Biotechnol Prog 32: 787. |
[3] |
Bhattacharyya PN, Jha DK (2012) Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World J Microbiol Biotechnol 28: 1327–1350. doi: 10.1007/s11274-011-0979-9
![]() |
[4] | Kloepper JW, Ryu CM (2006) Bacterial Endophytes as Elicitors of Induced Systemic Resistance, In: Microbial Root Endophytes, Berlin, Heidelberg: Springer, 33–52. |
[5] |
Bell CR, Dickie GA, Harvey WLG, et al. (1995) Endophytic bacteria in grapevine. Can J Microbiol 41: 46–53. doi: 10.1139/m95-006
![]() |
[6] | Patriquin DG, Döbereiner J (1978) Light microscopy observations of tetrazolium-reducing bacteria in the endorhizosphere of maize and other grasses in Brazil. Can J Microbiol 24: 734–742. |
[7] |
Jacobs MJ, Bugbee WM, Gabrielson DA (1985) Enumeration, location, and characterization of endophytic bacteria within sugar beet roots. Can J Bot 63: 1262–1265. doi: 10.1139/b85-174
![]() |
[8] |
Gray EJ, Smith DL (2005) Intracellular and extracellular PGPR: commonalities and distinctions in the plant-bacterium signaling processes. Soil Biol Biochem 37: 395–412. doi: 10.1016/j.soilbio.2004.08.030
![]() |
[9] |
Compant S, Clément C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42: 669–678. doi: 10.1016/j.soilbio.2009.11.024
![]() |
[10] | Ramos Solano B, Barriuso J, Gutirrez Maero FJ (2008) Physiological and Molecular Mechanisms of Plant Growth Promoting Rhizobacteria (PGPR), In: Plant-Bacteria Interactions: Strategies and Techniques to Promote Plant Growth, Weinheim: Wiley-VCH Verlag GmbH & Co. KGaA, 41–54. |
[11] | Hurek T, Egener T, Reinhold-Hurek AB (1997) Divergence in nitrogenases of Azoarcus spp. Proteobacteria of the beta subclass. J Bacteriol 179: 4172–4178. |
[12] |
Iniguez AL, Dong Y, Triplett EW (2004) Nitrogen fixation in wheat provided by Klebsiella pneumoniae 342. Mol Plant-Microbe Interact 17: 1078–1085. doi: 10.1094/MPMI.2004.17.10.1078
![]() |
[13] |
Sevilla M, Burris RH, Gunapala N, et al. (2001) Comparison of benefit to sugarcane plant growth and 15N2 incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wild-type and Nif– mutant strains. Mol Plant-Microbe Interact 14: 358–366. doi: 10.1094/MPMI.2001.14.3.358
![]() |
[14] |
Verma SC, Ladha JK, Tripathi AK (2001) Evaluation of plant growth promoting and colonization ability of endophytic diazotrophs from deep water rice. J Biotechnol 91: 127–141. doi: 10.1016/S0168-1656(01)00333-9
![]() |
[15] |
Costa JM (1994) Characterization of siderophore production by the biological control agent Enterobacter cloacae. Mol Plant-Microbe Interact 7: 440. doi: 10.1094/MPMI-7-0440
![]() |
[16] |
Santoyo G, Moreno-Hagelsieb G, Del COM, et al. (2016) Plant growth-promoting bacterial endophytes. Microbiol Res 183: 92–99. doi: 10.1016/j.micres.2015.11.008
![]() |
[17] |
Mohanty SR, Dubey G, Kollah B (2017) Endophytes of Jatropha curcas promote growth of maize. Rhizosphere 3: 20–28. doi: 10.1016/j.rhisph.2016.11.001
![]() |
[18] | Glick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res 169: 30–39. |
[19] | Elbeltagy A, Nishioka K, Sato T, et al. (2001) Endophytic colonization and in planta nitrogen fixation by a Herbaspirillum sp. isolated from wild rice species. Appl Environ Microbiol 67: 5285–5293. |
[20] |
Silva TFD, Vollú RE, Dias BDC, et al. (2017) Cultivable bacterial communities associated with roots of rose-scented geranium (Pelargonium graveolens) with the potential to contribute to plant growth. Appl Soil Ecol 111: 123–128. doi: 10.1016/j.apsoil.2016.12.002
![]() |
[21] |
Gomes NCM, Cleary DFR, Pinto FN, et al. (2010) Taking root: enduring effect of rhizosphere bacterial colonization in mangroves. PLoS One 5: e14065. doi: 10.1371/journal.pone.0014065
![]() |
[22] |
Pires ACC, Cleary DFR, Almeida A, et al. (2012) Denaturing gradient gel electrophoresis and barcoded pyrosequencing reveal unprecedented archaeal diversity in mangrove sediment and rhizosphere samples. Appl Environ Microbiol 78: 5520–5528. doi: 10.1128/AEM.00386-12
![]() |
[23] |
Uroz S, Buée M, Murat C, et al. (2010) Pyrosequencing reveals a contrasted bacterial diversity between oak rhizosphere and surrounding soil. Environ Microbiol Rep 2: 281–288. doi: 10.1111/j.1758-2229.2009.00117.x
![]() |
[24] |
Torres-Cortés G, Millán V, Fernández-González AJ, et al. (2012) Bacterial community in the rhizosphere of the cactus species Mammillaria carnea during dry and rainy seasons assessed by deep sequencing. Plant Soil 357: 275–288. doi: 10.1007/s11104-012-1152-4
![]() |
[25] | García-Fraile P, Carro L, Robledo M, et al. (2012) Rhizobium promotes non-legumes growth and quality in several production steps: Towards a biofertilization of edible raw vegetables healthy for humans. PLoS One 7: e38122. |
[26] |
İnceoğlu Ö, Al-Soud WA, Salles JF, et al. (2011) Comparative analysis of bacterial communities in a potato field as determined by pyrosequencing. PLoS One 6: e23321. doi: 10.1371/journal.pone.0023321
![]() |
[27] | Mendes R, Kruijt M, Bruijn I de, et al. (2011) Deciphering the rhizosphere microbiome for disease-suppressive bacteria. Science 332: 1097–1100. |
[28] | Roesch L, Fulthorpe R, Riva A, et al. (2007) Pyrosequencing enumerates and contrasts soil microbial diversity. ISME 1: 283–290. |
[29] |
DeAngelis K, Brodie E, DeSantis T (2009) Selective progressive response of soil microbial community to wild oat roots. ISME 3: 168–178. doi: 10.1038/ismej.2008.103
![]() |
[30] | Javid AP, Azra NK, Zaffar AR, et al. (2013) Screening of beneficial properties of rhizobacteria isolated from Saffron (Crocus sativus L) rhizosphere. African J Microbiol Res 7: 2905–2910. |
[31] |
Sharaf-Eldin M, Elkholy S, Fernández JA, et al. (2008) Bacillus subtilis FZB24 affects flower quantity and quality of saffron (Crocus sativus). Planta Med 74: 1316–1320. doi: 10.1055/s-2008-1081293
![]() |
[32] | Valle García-Rodríguez M, Serrano-Díaz J, Tarantilis PA, et al. (2014) Determination of saffron quality by high-performance liquid chromatography. J Agric Food Chem 62: 8068–8074. |
[33] |
Carmona M, Zalacain A, Salinas MR, et al. (2007) A new approach to saffron aroma. Crit Rev Food Sci Nutr 47: 145–159. doi: 10.1080/10408390600626511
![]() |
[34] | Carmona M, Zalacain A, Sánchez AM, et al. (2006) Crocetin esters, picrocrocin and its related compounds present in Crocus sativus stigmas and Gardenia jasminoides fruits. Tentative identification of seven new compounds by LC-ESI-MS. J Agric Food Chem 54: 973–979. |
[35] | Maggi L, Carmona M, Sánchez AM, et al. (2010) Saffron flavor: Compounds involved, biogenesis and human perception. Funct Plant Sci Technol 4 (Special Issue2): 45–55. |
[36] |
Ambardar S, Vakhlu J (2013) Plant growth promoting bacteria from Crocus sativus rhizosphere. World J Microbiol Biotechnol 29: 2271–2279. doi: 10.1007/s11274-013-1393-2
![]() |
[37] |
Tamura K, Dudley J, Nei M, et al. (2007) MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599. doi: 10.1093/molbev/msm092
![]() |
[38] |
Peix A, Rivas-Boyero AA, Mateos PF, et al. (2001) Growth promotion of chickpea and barley by a phosphate solubilizing strain of Mesorhizobium mediterraneum under growth chamber conditions. Soil Biol Biochem 33: 103–110. doi: 10.1016/S0038-0717(00)00120-6
![]() |
[39] |
Alexander DB, Zuberer DA (1991) Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol Fertil Soils 12: 39–45. doi: 10.1007/BF00369386
![]() |
[40] | O'hara GW, Goss TJ, Dilworth MJ, et al. (1989) Maintenance of intracellular pH and acid tolerance in Rhizobium meliloti. Appl Environ Microbiol 55: 1870–1876. |
[41] | Compant S, Reiter B, Sessitsch A, et al. (2005) Endophytic colonization of Vitis vinifera L. by plant growth-promoting bacterium Burkholderia sp. strain PsJN. Appl Environ Microbiol 71: 1685–1693. |
[42] |
Smalla K, Sessitsch A, Hartmann A (2006) The Rhizosphere: 'soil compartment influenced by the root'. FEMS Microbiol Ecol 56: 165–165. doi: 10.1111/j.1574-6941.2006.00148.x
![]() |
[43] |
Alves TMA, Kloos H, Zani CL (2003) Eleutherinone, a novel fungitoxic naphthoquinone from Eleutherine bulbosa (Iridaceae). Mem Inst Oswaldo Cruz 98: 709–712. doi: 10.1590/S0074-02762003000500021
![]() |
[44] | Ifesan B, Ibrahim D (2010) Antimicrobial activity of crude ethanolic extract from Eleutherine americana. J Food Agric & Environ 8: 1233–1236. |
[45] | Pearson WR (2014) BLAST and FASTA similarity searching for multiple sequence alignment, In: Multiple Sequence Alignment Methods, Human press, 75–101. |
[46] |
Hsieh TF, Huang HC, Mundel HH, et al. (2005) Resistance of common bean (Phaseolus vulgaris) to bacterial wilt caused by Curtobacterium flaccumfaciens pv. flaccumfaciens. J Phytopathol 153: 245–249. doi: 10.1111/j.1439-0434.2005.00963.x
![]() |
[47] | Kim MK, Kim YJ, Kim HB, et al. (2008) Curtobacterium ginsengisoli sp. nov., isolated from soil of a ginseng field. Int J Syst Evol Microbiol 58: 2393–2397. |
[48] | Behrendt U, Ulrich A, Schumann P, et al. (2002) Diversity of grass-associated Microbacteriaceae isolated from the phyllosphere and litter layer after mulching the sward; polyphasic characterization of Subtercola pratensis sp. nov., Curtobacterium herbarum sp. nov. and Plantibacter flavus gen. nov., sp. Int J Syst Evol Microbiol 52: 1441–1454. |
[49] |
Brian B (1977) Crocus sativus and its allies (Iridaceae). Plant Syst Evol 128: 89–103. doi: 10.1007/BF00985174
![]() |
[50] |
Alsayied NF, Fernández JA, Schwarzacher T, et al. (2015) Diversity and relationships of Crocus sativus and its relatives analysed by inter-retroelement amplified polymorphism (IRAP). Ann Bot 116: 359–368. doi: 10.1093/aob/mcv103
![]() |
[51] | Rodríguez H, Fraga R, Gonzalez T, et al. (2007) Genetics of phosphate solubilization and its potential applications for improving plant growth-promoting bacteria, In: First International Meeting on Microbial Phosphate Solubilization, Dordrecht: Springer, 15–21. |
[52] |
Verma SC, Ladha JK, Tripathi AK (2001) Evaluation of plant growth promoting and colonization ability of endophytic diazotrophs from deep water rice. J Biotechnol 91: 127–141. doi: 10.1016/S0168-1656(01)00333-9
![]() |
[53] | Kaur G, Reddy MS (2013) Phosphate solubilizing rhizobacteria from an organic farm and their influence on the growth and yield of maize (Zea mays L.). J Gen Appl Microbiol 59: 295–303. |
[54] | Alikhani HA, Saleh-Rastin N, Antoun H (2007) Phosphate solubilization activity of rhizobia native to Iranian soils, In: First International Meeting on Microbial Phosphate Solubilization, Dordrecht: Springer, 35–41. |
[55] | Ma Y, Prasad MNV, Rajkumar M, et al. (2011) Plant growth promoting rhizobacteria and endophytes accelerate phytoremediation of metalliferous soils. Biotechnol Adv 29: 248–258. |
[56] | Navarro L, Dunoyer P, Jay F, et al. (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312: 436–439. |
[57] | Weilharter A, Mitter B, Shin MV, et al. (2011) Complete genome sequence of the plant growth-promoting endophyte Burkholderia phytofirmans strain PsJN. J Bacteriol 193: 3383–3384. |
[58] | Taghavi S, Garafola C, Monchy S, et al. (2009) Genome survey and characterization of endophytic bacteria exhibiting a beneficial effect on growth and development of poplar trees. Appl Environ Microbiol 75: 748–757. |
[59] | Kobayashi T, Nishizawa NK (2012) Iron uptake, translocation, and regulation in higher plants. Annu Rev Plant Biol 63: 131–152. |
[60] | Crowley D (2006) Microbial siderophores in the plant rhizosphere. In: Iron nutrition in plants and rhizospheric microorganisms, Springer Netherlands, 169–198. |
[61] |
Schenk PM, Carvalhais LC, Kazan K (2012) Unraveling plant-microbe interactions: can multi-species transcriptomics help? Trends Biotechnol 30: 177–184. doi: 10.1016/j.tibtech.2011.11.002
![]() |
[62] | Siebner-Freibach H, Hadar Y, Chen Y (2003) Siderophores sorbed on Ca-montmorillonite as an iron source for plants. Plant Soil 251: 115–124. |
[63] |
Verma VC, Singh SK, Prakash S (2011) Bio-control and plant growth promotion potential of siderophore producing endophytic Streptomyces from Azadirachta indica A. Juss. J Basic Microbiol 51: 550–556. doi: 10.1002/jobm.201000155
![]() |
1. | Paulina Vega-Celedón, Guillermo Bravo, Alexis Velásquez, Fernanda P. Cid, Miryam Valenzuela, Ingrid Ramírez, Ingrid-Nicole Vasconez, Inaudis Álvarez, Milko A. Jorquera, Michael Seeger, Microbial Diversity of Psychrotolerant Bacteria Isolated from Wild Flora of Andes Mountains and Patagonia of Chile towards the Selection of Plant Growth-Promoting Bacterial Consortia to Alleviate Cold Stress in Plants, 2021, 9, 2076-2607, 538, 10.3390/microorganisms9030538 | |
2. | Alejandro Jiménez-Gómez, José David Flores-Félix, Paula García-Fraile, Pedro F. Mateos, Esther Menéndez, Encarna Velázquez, Raúl Rivas, Probiotic activities of Rhizobium laguerreae on growth and quality of spinach, 2018, 8, 2045-2322, 10.1038/s41598-017-18632-z | |
3. | Omid Askari-Khorasgani, Mohammad Pessarakli, Shifting saffron (Crocus sativus L.) culture from traditional farmland to controlled environment (greenhouse) condition to avoid the negative impact of climate changes and increase its productivity, 2019, 42, 0190-4167, 2642, 10.1080/01904167.2019.1659348 | |
4. | Diogo Mina, José Alberto Pereira, Teresa Lino-Neto, Paula Baptista, Epiphytic and Endophytic Bacteria on Olive Tree Phyllosphere: Exploring Tissue and Cultivar Effect, 2020, 80, 0095-3628, 145, 10.1007/s00248-020-01488-8 | |
5. | Evan Mayer, Patricia Dörr de Quadros, Roberta Fulthorpe, Isaac Cann, Plantibacter flavus, Curtobacterium herbarum, Paenibacillus taichungensis, and Rhizobium selenitireducens Endophytes Provide Host-Specific Growth Promotion of Arabidopsis thaliana, Basil, Lettuce, and Bok Choy Plants, 2019, 85, 0099-2240, 10.1128/AEM.00383-19 | |
6. | Vishal Gupta, Akash Sharma, Pradeep Kumar Rai, Sushil Kumar Gupta, Brajeshwar Singh, Satish Kumar Sharma, Santosh Kumar Singh, Rafakat Hussain, Vijay Kumar Razdan, Devendra Kumar, Shazia Paswal, Vinod Pandit, Rohit Sharma, Corm Rot of Saffron: Epidemiology and Management, 2021, 11, 2073-4395, 339, 10.3390/agronomy11020339 | |
7. | Nina Bziuk, Lorrie Maccario, Benjamin Straube, Gwendolin Wehner, Søren J. Sørensen, Adam Schikora, Kornelia Smalla, The treasure inside barley seeds: microbial diversity and plant beneficial bacteria, 2021, 16, 2524-6372, 10.1186/s40793-021-00389-8 | |
8. | Li Tian, Shuang Hu, Xingxing Wang, Yingqiu Guo, Luyang Huang, Lili Wang, Wankui Li, Antagonism of Rhizosphere Streptomyces yangpuensis CM253 against the Pathogenic Fungi Causing Corm Rot in Saffron (Crocus sativus L.), 2022, 11, 2076-0817, 1195, 10.3390/pathogens11101195 | |
9. | Shirin Moradi, 2022, Chapter 13, 978-3-031-09999-1, 221, 10.1007/978-3-031-10000-0_13 | |
10. | Junjira Satitmunnaithum, Hiroaki Kitazawa, Nur Akbar Arofatullah, Ani Widiastuti, Agung Dian Kharisma, Kenji Yamane, Sayuri Tanabata, Tatsuo Sato, Microbial population size and strawberry fruit firmness after drop shock-induced mechanical damage, 2022, 192, 09255214, 112008, 10.1016/j.postharvbio.2022.112008 | |
11. | Kaylee A. South, Nathan P. Nordstedt, Michelle L. Jones, Identification of Plant Growth Promoting Rhizobacteria That Improve the Performance of Greenhouse-Grown Petunias under Low Fertility Conditions, 2021, 10, 2223-7747, 1410, 10.3390/plants10071410 | |
12. | Yaser Esmaeilian, Mohammad Behzad Amiri, Abolfazl Tavassoli, Andrés Caballero-Calvo, Jesús Rodrigo-Comino, Replacing chemical fertilizers with organic and biological ones in transition to organic farming systems in saffron (Crocus sativus) cultivation, 2022, 307, 00456535, 135537, 10.1016/j.chemosphere.2022.135537 | |
13. | Peter Evseev, Anna Lukianova, Rashit Tarakanov, Anna Tokmakova, Anastasia Popova, Eugene Kulikov, Mikhail Shneider, Alexander Ignatov, Konstantin Miroshnikov, Prophage-Derived Regions in Curtobacterium Genomes: Good Things, Small Packages, 2023, 24, 1422-0067, 1586, 10.3390/ijms24021586 | |
14. | Stefania Stelluti, Matteo Caser, Sonia Demasi, Esteban Rodriguez Herrero, Irene García-González, Erica Lumini, Valeria Bianciotto, Valentina Scariot, Beneficial microorganisms: a sustainable horticultural solution to improve the quality of saffron in hydroponics, 2023, 319, 03044238, 112155, 10.1016/j.scienta.2023.112155 | |
15. | Eloísa Pajuelo, Noris J. Flores-Duarte, Salvadora Navarro-Torre, Ignacio D. Rodríguez-Llorente, Enrique Mateos-Naranjo, Susana Redondo-Gómez, José A. Carrasco López, Culturomics and Circular Agronomy: Two Sides of the Same Coin for the Design of a Tailored Biofertilizer for the Semi-Halophyte Mesembryanthemum crystallinum, 2023, 12, 2223-7747, 2545, 10.3390/plants12132545 | |
16. | Nilofer Ali, Aparna Maitra Pati, PGPR mediated enhancement of saffron corm production in non-traditional area of Himachal Pradesh, India, 2023, 161, 02546299, 434, 10.1016/j.sajb.2023.08.019 | |
17. | Thị Anh Thy Châu, Thị Kiều Oanh Nguyễn, Ngọc Hoài Nguyễn, Minh Trí Trương, Khởi Nghĩa Nguyễn, Ảnh hưởng của hai dòng vi khuẩn Curtobacterium citreum HH5 và Curtobacterium luteum MT6 đến sinh trưởng, năng suất cải xanh (Brassica Juncea) và đặc tính đất ở điều kiện nhà lưới, 2023, 59, 2815-5599, 10.22144/ctujos.2023.200 | |
18. | Alejandra Fuentes-Quiroz, Héctor Herrera, Roxana Alvarado, Claudia Rabert, Cesar Arriagada, Rafael Borges da Silva Valadares, Functional differences of cultivable leaf-associated microorganisms in the native Andean tree Gevuina avellana Mol. (Proteaceae) exposed to atmospheric contamination, 2024, 135, 1365-2672, 10.1093/jambio/lxae041 | |
19. | S. Stelluti, M. Caser, S. Demasi, E. Rodriguez Herrero, I. García-González, E. Lumini, V. Bianciotto, V. Scariot, Plant growth promoting rhizobacteria: a sustainable way towards improving the quality of saffron, 2025, 0567-7572, 201, 10.17660/ActaHortic.2025.1416.26 | |
20. | Annabel Arhin, Sydney Wiegand, Isabella Foriska, Kiersten Brown, Kylee Crayne, Kaitlyn Stroscio, Rajinikanth Mohan, Comparative Analysis of Endophytic Curtobacterium Species Reveals Commonalities and Adaptations, 2025, 4, 2674-1334, 25, 10.3390/bacteria4020025 |
Treatments | Total number of flowers | Saffron threads length (cm) ± S.E* | Saffron yield (g) ± S.E.* |
Control | 28 | 2.85 ± 0.0039a* | 0.007 ± 0.001a* |
Cs10 | 29 | 3.10 ± 0.0035b* | 0.013 ± 0.001b* |