Review Special Issues

PEST analysis of the future Chinese vertical farming market: Environmental sustainability and energy savings

  • To provide people with an insight into market development in the Chinese vertical farming (VF) industry, this work has conducted a PEST analysis to identify the external market environment from political, economic, social and technological perspectives. VF is developing at a rapid speed with great market potential and opportunities. Environmental pollution and consumersx increased awareness of a healthy lifestyle drive Chinese people to seek "safety, healthier and clean" food more than anyone else in the world. The increasing gross domestic product enables more and more people to afford VF-produced products. The great market opportunities have attracted many domestic and international investors to join the market. Until 2020, there were more than 200 plant factories operating in China, and the number is increasing. Nevertheless, the development of vertical farms is in the initial stage in China, which can be summarized as follows: 1) the high investment and operational costs are the main barriers to profitability; 2) technology development still lags behind other VF-advanced countries, such as in the development of intelligent crop management equipment; 3) insufficient government support, as promoting a vertical farm market requires more efficient political and financial support from the Chinese government; and 4) consumer public awareness of VF is too low.

    Citation: Shuang Ning, George Xydis. PEST analysis of the future Chinese vertical farming market: Environmental sustainability and energy savings[J]. AIMS Agriculture and Food, 2023, 8(2): 496-512. doi: 10.3934/agrfood.2023026

    Related Papers:

    [1] Sharon L. Casapulla, Gloria Aidoo-Frimpong, Tania B. Basta, Mario J. Grijalva . Zika virus knowledge and attitudes in Ecuador. AIMS Public Health, 2018, 5(1): 49-63. doi: 10.3934/publichealth.2018.1.49
    [2] Paulina Januszko, Ewa Lange . Nutrition, supplementation and weight reduction in combat sports: a review. AIMS Public Health, 2021, 8(3): 485-498. doi: 10.3934/publichealth.2021038
    [3] Dimitris Zavras . A cross-sectional population-based study on the influence of the COVID-19 pandemic on incomes in Greece. AIMS Public Health, 2021, 8(3): 376-387. doi: 10.3934/publichealth.2021029
    [4] Laura Gonzalo-Ciria, Marta Pérez De Heredia-Torres, María Isabel Vidal-Sánchez, María José López-de-la-Fuente, Elisa Bullón-Benito, Ana Poveda-García, Mariana Ortiz-Piña, María Cristina Ruiz-Garrós, Ana Gascón-Catalán . Loss of productivity among caregivers of dependent family members. AIMS Public Health, 2025, 12(2): 451-469. doi: 10.3934/publichealth.2025025
    [5] Carmen Lok Tung Ho, Olivia Oligbu, Fatma Asaid, Godwin Oligbu . Does norovirus induce acute hepatitis?. AIMS Public Health, 2020, 7(1): 148-157. doi: 10.3934/publichealth.2020013
    [6] María D Figueroa-Pizano, Alma C Campa-Mada, Elizabeth Carvajal-Millan, Karla G Martinez-Robinson, Agustin Rascon Chu . The underlying mechanisms for severe COVID-19 progression in people with diabetes mellitus: a critical review. AIMS Public Health, 2021, 8(4): 720-742. doi: 10.3934/publichealth.2021057
    [7] Heitham Awadalla, Fateh El-Samani, Mohammed A. Soghaier, Mahgoub Makki . Risk Factors Associated with the Development of Tuberculosis Among HIV-Infected Patients in Khartoum in 2010. AIMS Public Health, 2015, 2(4): 784-792. doi: 10.3934/publichealth.2015.4.784
    [8] Junji Takaya . Small for Gestational Age and Magnesium: Intrauterine magnesium deficiency may induce metabolic syndrome in later life. AIMS Public Health, 2015, 2(4): 793-803. doi: 10.3934/publichealth.2015.4.793
    [9] Taija Finni, Marja Uusi-Vähälä, Arto J. Pesola, Ritva S. Taipale . Do Running and Strength Exercises Reduce Daily Muscle Inactivity Time?. AIMS Public Health, 2016, 3(4): 702-721. doi: 10.3934/publichealth.2016.4.702
    [10] Ehsan Shoohanizad, Ata Garajei, Aida Enamzadeh, Amir Yari . Nonsurgical management of temporomandibular joint autoimmune disorders. AIMS Public Health, 2019, 6(4): 554-567. doi: 10.3934/publichealth.2019.4.554
  • To provide people with an insight into market development in the Chinese vertical farming (VF) industry, this work has conducted a PEST analysis to identify the external market environment from political, economic, social and technological perspectives. VF is developing at a rapid speed with great market potential and opportunities. Environmental pollution and consumersx increased awareness of a healthy lifestyle drive Chinese people to seek "safety, healthier and clean" food more than anyone else in the world. The increasing gross domestic product enables more and more people to afford VF-produced products. The great market opportunities have attracted many domestic and international investors to join the market. Until 2020, there were more than 200 plant factories operating in China, and the number is increasing. Nevertheless, the development of vertical farms is in the initial stage in China, which can be summarized as follows: 1) the high investment and operational costs are the main barriers to profitability; 2) technology development still lags behind other VF-advanced countries, such as in the development of intelligent crop management equipment; 3) insufficient government support, as promoting a vertical farm market requires more efficient political and financial support from the Chinese government; and 4) consumer public awareness of VF is too low.



    Noise-induced hearing loss (NIHL) is one of the most common occupational disease experienced across the world in occupational environments [1] and the second most common cause of acquired hearing loss after presbyacusis [2]. It has been estimated that about 500 million individuals might be at increased risk of developing NIHL [3].

    There is a large individual variability in susceptibility to the damaging effects of noise; after exposure to similar level of noise, some subjects develop different level of NIHL, so has been proposed that NIHL is a complex disease that is influenced by interaction of environmental and genetic factors [4]. Environmental risk factors causing hearing loss include noise, vibration, heat, chemicals such as organic solvents and heavy metals, ototoxic drugs, infections, nutrient disturbances, smoking, high blood pressure and cholesterol levels and possibly pigmentation [4],[5].

    Little is known about the involvement of genetic factors that influence NIHL in human. Several NIHL susceptibility genes have been suggested, such as, genes encoding for the antioxidant systems, potassium ion channels, heat shock proteins, and the signaling function of the immune system [6]. Oxidative stress genes, such as glutathione S-transferase, (GST); glutathione peroxidase (GPX1); glutathione reductase (GSR), superoxide dismutases (SOD), catalase (CAT), and paraoxonase (PON) [6] are obvious candidate genes for NIHL [7]. Numerous studies have shown that high-intensity noise exposure causes mechanical or metabolic changes in the cochlea which lead inner ear damage [8]. The metabolic changes are caused mainly by increase in free radical species (FRS) that play a primary role in NIHL [9]. The harmful effects of FRS are generally prevented by endogenous antioxidants. Tripeptide glutathione (GSH), a major intracellular antioxidant, is proven to detoxify free radicals and to prevent NIHL [10]. The most important antioxidant enzymes in the cochlea that are involved in GSH metabolism are glutathione S-transferase (GST), glutathione peroxidase (GPX1), and glutathione reductase (GSR) [10]. GST enzymes catalyze conjugation of GSH with free radicals and have an important role protecting the cochlea [11]. GST classified into several gene classes (GSTA, GSTM, GSTP, GSTT, GSTZ, GSTS, GSTK, GSTO) [5]. In humans, there is genetic variability of GSTT1 and GSTM1. Up to 50% of the Caucasian population has null genotype for GSTM1 [12], while 25–40% of the Caucasian population are null for GSTT1 gene [13]. Individuals with the null genotype for either GSTT1 or GSTM1 cannot conjugate toxins specific to these enzymes, so they may be at increased risk of developing NIHL [14].

    There are limited and inconsistent results about association between variation in GST genes and susceptibility to NIHL. Rabinowitz et al. showed that among 58 noise-exposed American workers, GSTM1 null individuals had lower amplitudes of high frequency otoacustic emissions compared to individuals possessing the gene. However their finding lacked sufficient power and this may be a spurious finding [14]. In later study involving 194 Chinese workers who exposed to occupational noise, Yang et al. suggested that GSTT1 null individuals might be more susceptible to NIHL [15]. Lin et al. found that among 58 noise-exposed workers in Taiwan, individuals carrying all genotypes with GSTM1 null, GSTT1 null, and GSTP1 I1e105/I1e105 might be more susceptible to the effects of noise [10]. However in much more comprehensive study among 10% most susceptible and 10% most resistant to noise subjects selected from 1200 Swedish workers, an association between GSTT1, GSTM1, and GSTP1 could not be confirmed [11]. Palodetto et al. found no significant association between GST gene variants (GSTT1 and GSTM1) and ototoxicity of aminoglycosides, which seems to involve similar oxidative stress mechanisms [16]. In addition to contradictory results in various studies, the effect of genetic factors on susceptibility of NIHL can only be regarded as valid when they have been replicated in an independent population [17]; so, the present study investigates the association between the deletion polymorphism in the GSTT1 (rs1049055) and GSTM1 (rs10712361) genes and susceptibility to NIHL in Iranian population.

    This case-control study was performed in accordance with the guidelines in the Declaration of Helsinki and with approval from the medical ethics committee of Shahid Sadoughi University of medical sciences, Iran. An informed consent was obtained from all study subjects.

    The present study was conducted on male workers from 7 tile and ceramic factories in Yazd, a center province of Iran. Factories which had high stability of the workforce and had periodic noise level measurements were selected by simple random sampling from all tile and ceramic factories in Yazd (n = 30). In each factory subjects who had been employed for at least 3 years and exposed to hazardous noise (≥ 85 dBA) were selected by simple random sampling [11]. Noise level was extracted from the result of measurements routinely performed in the factories by industrial hygiene incorporations.

    Those with previous history of acoustic trauma, congenital or familial hearing loss, and ototoxic drug consumption, positive medical history of diabetes mellitus, hypertension, head trauma, head surgery, chronic otitis media, conductive hearing loss in pure-tone audiometry, previous exposure to organic solvents or loud noise in previous or second job or in non-occupational form, and family history of deafness were excluded from the study.

    A questionnaire including age, duration of employment in current job, smoking and alcohol consumption and medical history was filled for each subject.

    After usual otoscopic examination, pure-tone audiometry (using clinical audiometer: Interacoustic, AC40, Denmark, headphone: TDH39) was performed for the subjects in an acoustic chamber meeting the requirements of the American National Standards Institution (ANSI) 2004 by an expert audiologist (blinded to the study) [12]. Air conduction was assessed at 250, 500, 1000, 2000, 3000, 4000, 6000, and 8000 Hz frequencies and bone conduction at 250–4000 Hz frequencies for each ear.

    After considering inclusion and exclusion criteria, according to the result of audiometry, subjects were classified into two groups: from 80 NIHL subjects, 73 individuals with audiograms suggestive NIHL as a case group (8 were excluded due to diabetes mellitus, conductive hearing loss, familial hearing loss and history of head trauma) and from total 90 subjects, 87 normal hearing individuals enrolled in the study as controls [13], (3 were excluded due to conductive hearing loss and diabetes mellitus). Their workday was approximately 8 hours per day. Most workers did not use hearing protective devices (ear plugs) and a few workers used ear plugs very irregularly.

    Venous blood samples for DNA extraction were also collected in EDTA tubes at the workplace and placed immediately container and then transported on dry ice to the laboratory. This extraction was carried out under sterile conditions and under the laminar hood. DNA extraction from blood was performed using a DNA extraction kit called Bio Flux (Shanghai Beiyi Bioequip Information Co., china). The next step was DNA extraction for use in the polymerase chain reaction. The purpose of the multiplex PCR was to amplify the genomic DNA regions containing GSTT1 (Forward primer: 5′ TTCCTTACTGGTCCTCACATCTC 3, Reverse primer: 5′ TCACCGGATCATGGCCAGCA 3′), and GSTM1 (Forward primer: 5′ GAACTCCCTGAAAAGCTAAAGC 3′, Reverse primer: 5′ GTTGGGCTCAAATATACGGTGG 3′) in addition to the B-globin gene as control. At this stage, 15 µl Master Mix 2x (cinnagen, Iran) (which itself contains 2mM MgCl2), was made up of a total volume of 30 µl: containing 100 ng of genomic DNA and 12.5 pM each of the forward and reverse GSTT1, GSTM1, and B-globin primers.

    The PCR reaction was carried out in 3 steps, one cycle of 94 °C for 5 minutes followed by 30 cycles of 94 °C for 1 min, 62 °C for 1 min, and 72 °C for 1 min and the final step was 72 degrees for 5 minutes. The PCR product was run in 2% (w/v) agarose gel and the bands were visualized with UV light.

    Three bands should be observed: The B-globin band to be observed in all wells is 268 bp, GSTT band is 480 bp and GSTM band is 219 bp. Both GSTM and GSTT bands may exist or have been deleted, creating four different patterns: T+ M+, T+ M−, T− M+ or T− M−.

    Data was analyzed by SPSS version 18 (SPSS, Inc., Chicago, IL). One-Sample Kolmogorov-Smirnov test was applied to test normality of study variables. Independent Student's t-test and Mann-Whitney test were used to compare continuous variables between groups. The frequency of polymorphism was compared between groups by chi-square test and Fisher's exact test and odds ratios with corresponding 95% confidence intervals (95% CI) were calculated with Mantel-Haenszel method. P-value ≤ 0.05 was considered statistically significant.

    A total of 160 male subjects that comprised 73 individuals with audiograms suggestive NIHL as a case group and 87 normal hearing individuals as a controls participated in this study. Table 1 presents the demographic and personal characteristics of the study subjects.

    Table 1.  Characteristic of the study population.
    Case group (n = 73) Control group (n = 87) P-Value
    Age (years)* (Mean±SD) 35.12 ± 3.85 34.71 ± 4.21 0.07
    Employment (years) (Mean±SD) 6.40 ± 2.39 6.37 ± 1.72 0.90
    Noise exposure (TWA) dBA (Mean±SD) 90.14 ± 2.59 89.72 ± 2.32 0.26
    Smoking 9N (%)] 19 (26.00%) 14 (16.10%) 0.09

    Note: *Student's t-test; Mann-Whitney test; Chi-square test.

     | Show Table
    DownLoad: CSV

    Null GSTT1 and null GSTM1 were found in 33 persons (20.6%) and 54 individuals (33.8%) of the study population, respectively. The frequency of null GSTT1 and GSTM1 genotypes and interaction between these genes as well as the comparison of the results among NIHL and control groups are shown on table 2. Null GSTT1 and GSTM1 genotypes were more frequent in NIHL group but no significant statistical difference was seen in NIHL and control groups.

    Table 2.  Null genotypes from genes GSTT1 and GSTM1 in case and control groups.
    Genotypes Case group n (%) Control group n (%) p-value 0R (95% CI)
    GSTT1
    Normal genotype 57 (78.1) 70 (80.5) 0.43 1.08 (0.72–1.61)
    Null genotype 16 (21.9) 17 (19.5)
    GSTM1
    Normal genotype 45 (61.6) 61 (70.1) 0.17 1.22 (0.87–1.71)
    Null genotype 28 (38.4) 26 (29.9)

     | Show Table
    DownLoad: CSV

    No significant interaction between GSTT1 and GSTM1 genotypes was found (P-Value > 0.05) (Figure 1).

    Figure 1.  Interaction between GSTT1 and GSTM1 genotypes in case and control groups.

    The aim of this study was to assess that genetic variability of GSTT1 and GSTM1 is associated with susceptibility to NIHL in Iranian population.

    It seems that many factors play a role in NIHL including genetic and environmental factors. Subjects who developing NIHL after exposure to noise are often exposed to many other risk factors that interact with each other and/or with genetic factors [14].

    This study did not detect that the genetic variability of GSTT1 and GSTM1 affect on susceptibility to noise induced hearing loss. There are many controversial studies on association variations in oxidative stress genes and susceptibility to NIHL. Carlsson et al. analyzed genetic polymorphism in the 10% most susceptible and 10% most resistant extremes of 1200 Swedish noise-exposed workers to investigate whether genetic variation is associated with susceptibility to NIHL. In their study no significant differences were found between 103 noise-susceptible and 114 noise-resistant Swedish workers from the point of view of GSTM1 and GSTT1 polymorphism [6]. Palodetto et al. showed that polymorphism in GSTM1 and GSTT1 have no influence on ototoxicity of aminoglycosides, which seem to involve similar oxidative stress mechanis like NIHL [14]. Rabinowitz et al. analyzed polymorphism status for GSTM1 and GSTT1 in 58 factory workers [9]. They found that carriers of GSTM1 gene had better high frequency otoacoustic emission (OAEs) compared to GSTM1 null individuals but they found no significant effect of GSTM1 with pure tone audiogram. On the other hand GSTT1 did not show a protective effect. Their study lacks sufficient power due to small sample size. On the other hand, in a study in China, there was no significant relationship between GSTM1 gene deletion NIHL but the results suggested that GSTT1 polymorphism might play an important role in the development of NIHL in Chinese workers and the individuals with the GSTT1 null genotype might be more susceptible to NIHL [15] while in another study on Chinese workers, individuals with the GSTM1 null genotype had a statistically significantly increased risk of NIHL [22]. Study on 53 Taiwan male workers showed that GST polymorphism may modify the susceptibility to NIHL and that individuals carrying all genotypes with GSTT1 null, GSTM1 null, and GSTP1 Ile(105)/Ile(105) are more susceptible to NIHL [5].

    The findings of study on Brazilian subjects (107 subjects with NIHL, 44 with other causes of hearing loss and 104 controls) suggest effects of GSTT1 and GSTM1 polymorphism on the risk of NIHL [2]. In study conducted by Manche and et al. on 220 subjects with presbycusis, gene polymorphisms of GSTT1/M1were found to contribute significant risk to presbycusis [23].

    Several studies showed that antioxidant system is activated after noise exposure. It seems that noise exposure levels are important in activation of this system. So, it is possible in studies that did not find association of GST gene and NIHL, like our study, the noise exposure levels to which the majority of study workers have been exposed over the years did not reach the critical level needed to activate the antioxidant system, and therefore differences in their antioxidant systems are unlikely to show up in their findings. However, it is possible that difference exists when subetaoups (noise exposure levels, noise exposure times) be evaluated separately [6].

    Our results showed that the observed frequency of null GSTT1 and null GSTM1 were 20.6% and 33.8%, respectively. The 20.6% frequency of null GSTT1 is on the low end of the range of 19–58% reported in some Asian populations also the 33.8%, frequency of null GST M1 is of the range of 28–63% reported in some Asian populations [5]. 25 to 40% of the European population has GSTT1 deletions also GSTM1 gene deletions have been reported up to 50% of European population [3].

    Our study has several limitations. First of all, it was a cross-sectional study, and may therefore distort the association due to the healthy worker effect, and does not allow demonstration of a causal relationship. Secondly, this study lacks sufficient power due to small sample size. NIHL has complex nature that is influenced by interaction of environmental and genetic factors [14]; so many other environmental risk factors can have a confusing effect on this relationship, such as potential influence of length of time that the subjects have been exposed to non-occupational noisy conditions, commitment to using hearing protection devices at workplace and etc., As well as other risk factors (e.g., obesity, diet) have not been analyzed. A study conducted in 2006, suggested that to get better results on studies on NIHL susceptibility genes, 10% of the subjects with the worst hearing thresholds as susceptible to NIHL workers and 10% of the subjects with the best hearing thresholds as resistant to noise workers should classify by international reference standard such as ISO 1999:1990 standard [24].

    Due to the impact of ethnic differences on the gene level, the associations can only be valid when they have been replicated in an independent population, therefore, this study was conducted for the first time on the Iranian population.

    We did not detect that the genetic variability of GSTT1 and GSTM1 effect on susceptibility to noise induced hearing loss in Iranian population. Further studies should include workers with different noise exposure patterns. Combination of genes variation with other risk factors should also be analyzed.

    (1). Noise-induced hearing loss is a complex disease affected by both genetic and environmental factors.

    (2). Several Noise-induced hearing loss susceptibility genes has been suggested but oxidative stress genes are obvious candidate genes. One of important antioxidant enzymes in the cochlea are glutathione S-transferase (GST).

    (3). This study investigates the association between GST gene polymorphism and noise induced hearing loss among Iranian noise-exposed workers.

    (4). Further studies should include different population with different noise exposure patterns such as noise exposure levels, noise exposure times.



    [1] Dorling D (2021) World population prospects at the UN: Our numbers are not our problem?. In: The Struggle for Social Sustainability, Policy Press, 129–154. https://doi.org/10.1332/policypress/9781447356103.003.0007
    [2] Jansen G, Cila N, Kanis M, et al. (2016) Attitudes towards vertical farming at home: A user study. In: Proceedings of the 2016 CHI Conference Extended Abstracts on Human Factors in Computing Systems, Association for Computing Machinery, New York, NY, USA, 3091–3098. https://doi.org/10.1145/2851581.2892474
    [3] Kalantari F, Mohd Tahir O, Mahmoudi Lahijani A, et al. (2017) A review of vertical farming technology: A guide for implementation of building integrated agriculture in cities. Adv Eng Forum 24: 76–91. https://doi.org/10.4028/www.scientific.net/AEF.24.76 doi: 10.4028/www.scientific.net/AEF.24.76
    [4] Shao Y, Zhou Z, Hu Z, et al. (2020) An analysis of the research status of vertical farms based on bibliometrics. J Huazhong Agric Univ 39: 144–154. https://doi.org/10.13300/j.cnki.hnlkxb.2020.06.020 (In Chinese) doi: 10.13300/j.cnki.hnlkxb.2020.06.020(InChinese)
    [5] Jürkenbeck K, Heumann A, Spiller A (2019) Sustainability matters: Consumer acceptance of different vertical farming systems. Sustainability 11: 4052. https://doi.org/10.3390/su11154052 doi: 10.3390/su11154052
    [6] Avgoustaki DD, Xydis G (2021) Energy cost reduction by shifting electricity demand in indoor vertical farms with artificial lighting. Biosyst Eng 211: 219–229. https://doi.org/10.1016/j.biosystemseng.2021.09.006 doi: 10.1016/j.biosystemseng.2021.09.006
    [7] Pavithra MP (2018) May, Vertical Farming: A concept. Int J Eng Tech 4: 3.
    [8] Manos DP, Xydis G (2022) A multi-criteria linear model on carbon footprint in vertical farms and its relation to energy demand and operational costs. Environ Sci Pollut Res 29: 79331–79342. https://doi.org/10.1007/s11356-022-21396-3 doi: 10.1007/s11356-022-21396-3
    [9] Manos DP, Xydis G (2019). Hydroponics: Are we moving towards that direction only because of the environment? A discussion on forecasting and a systems review. Environ Sci Pollut Res 26: 12662–12672. https://doi.org/10.1007/s11356-019-04933-5 doi: 10.1007/s11356-019-04933-5
    [10] Pascual MP, Lorenzo GA, Gabriel AG (2018) Vertical farming using hydroponic system: Toward a sustainable onion production in Nueva Ecija, Philippines. Open J Ecol 8: 25. https://doi.org/10.4236/oje.2018.81003 doi: 10.4236/oje.2018.81003
    [11] Cifuentes‐Torres L, Mendoza‐Espinosa LG, Correa‐Reyes G, et al. (2021) Hydroponics with wastewater: A review of trends and opportunities. Water Environ J 35: 166–180. https://doi.org/10.1111/wej.12617 doi: 10.1111/wej.12617
    [12] Xydis GA, Liaros S, Avgoustaki DD (2020) Small scale plant factories with artificial lighting and wind energy microgeneration: A multiple revenue stream approach. J Cleaner Prod 255: 120227. https://doi.org/10.1016/j.jclepro.2020.120227 doi: 10.1016/j.jclepro.2020.120227
    [13] Harris ZM, Kountouris Y (2020) Vertical farming as a game changer for BECCS technology deployment. Sustainability 12: 8193. https://doi.org/10.3390/su12198193 doi: 10.3390/su12198193
    [14] Kozai T (2018) Plant factories with artificial lighting (PFALs): Benefits, problems, and challenges. In: Smart Plant Factory, Springer, Singapore, 15–29. https://doi.org/10.1007/978-981-13-1065-2_2
    [15] United Nations (2018) 68% of the world population projected to live in urban areas by 2050, says UN. Available from: https://www.un.org/development/desa/en/news/population/2018-revision-of-world-urbanization-prospects.html.
    [16] Forward Research Institute (2020) Development status of fresh food market in China in 2020. Available from: https://www.qianzhan.com/analyst/detail/220/201102-f6e67acc.html.
    [17] Huebbers JW, Buyel JF (2021) On the verge of the market–plant factories for the automated and standardized production of biopharmaceuticals. Biotechnol Adv 46: 107681. https://doi.org/10.1016/j.biotechadv.2020.107681 doi: 10.1016/j.biotechadv.2020.107681
    [18] Wang X, Vladislav Z, Viktor O, et al. (2022) Online recognition and yield estimation of tomato in plant factory based on YOLOv3. Sci Rep 12: 8686. https://doi.org/10.1038/s41598-022-12732-1 doi: 10.1038/s41598-022-12732-1
    [19] Yan X (2020) Chinese startup gets in on ground floor of high-rise farms. Available from: https://asia.nikkei.com/Business/Startups/Chinese-startup-gets-in-on-ground-floor-of-high-rise-farms.
    [20] Xin Hua News (2017) Zhongke Sananbio plant factory. Available from: http://www.cas.cn/cm/201704/t20170426_4598392.shtml.
    [21] SANANBIO (2019) The innovative and developing Zhongke SANANBIO plant factory industry. Available from: https://www.sananbio.com.cn/storyDetail/10.
    [22] SANANBIO (2021) Builders of a sustainable future. Available from: https://www.sananbious.com/.
    [23] Ledinside.cn (2018) Exploring the self-operated plant factory in JD.COM, its business model will be replicated globally. Available from: https://www.ledinside.cn/news/20180622-43705.html (In Chinese).
    [24] CHINADAILY.COM.CN (2019) BOE Smart Plant Factory: When agriculture has a "brain", every grain in the plate is AI. Available from: http://tech.chinadaily.com.cn/a/201907/01/WS5d19a0fba3108375f8f2d608.html.
    [25] Koumoulides D, Katsenios N, Kasimatis CN, et al. (2022) Socio-economic impact of the imposed lockdowns in food chains. A case study in Cyprus. Environments 9: 137. https://doi.org/10.3390/environments9110137 doi: 10.3390/environments9110137
    [26] Despommier D (2019) Vertical farms, building a viable indoor farming model for cities. Field Actions Science Reports. The Journal of Field Actions 20: 68–73.
    [27] Avgoustaki DD, Li J, Xydis G (2020) Basil plants grown under intermittent light stress in a small-scale indoor environment: Introducing energy demand reduction intelligent technologies. Food Control 118: 107389. https://doi.org/10.1016/j.foodcont.2020.107389 doi: 10.1016/j.foodcont.2020.107389
    [28] Yang Q (2014) Development strategy of plant factory. Sci Technol Rev 32: 20–24. https://doi.org/10.3981/j.issn.1000-7857.2014.10.002 (In Chinese). doi: 10.3981/j.issn.1000-7857.2014.10.002(InChinese)
    [29] Zheng J, Wang Q, Zhang Y, et al. (2020) An analysis of the omni-channel supply chain model of vertical farms. Intelligent City 4: 64–66. (In Chinese)
    [30] GAP report (2023) China ramps up peri-urban farming for Beijing consumers. Available from: https://globalagriculturalproductivity.org/case-study-post/china-ramps-up-peri-urban-farming-for-beijing-consumers/.
    [31] Abbasi AS, Aamir SM (2021) Sustainable development: Factors influencing public intention towards vertical farming in China and moderating role of awareness. J Soc Political Sci 4: 93–103. https://doi.org/10.31235/osf.io/ws7ay doi: 10.31235/osf.io/ws7ay
    [32] Yang Q (2015) Current situation & prophase exploration on vertical farm and urban agriculture in China. Available from: https://vertical-farming.net/wp-content/uploads/2015/03/2015-05-10-Prof.-Yang-Qichang-Intro-to-Vertical-Farming-in-China.pdf.
    [33] State Council of China (2016) The State Council on Printing and Distributing the National Agricultural Modernization Planning (2016–2020). The Central People's Government of the People's Republic of China. Available from: http://www.gov.cn/zhengce/content/2016-10/20/content_5122217.htm.
    [34] Yicai.com (2020) Top ten GDP cities in 2020: Guangzhou narrowly beat Chongqing and Nanjing entered the list for the first time. Available from: https://www.yicai.com/news/100935407.html.
    [35] Mckinsey (2020) Chinese Consumer Survey Report 2020. Available from: https://www.mckinsey.com.cn/wp-content/uploads/2019/12.
    [36] Baidu Consultancy (2019) Organic food industry analysis, Baidu Knowledge. Available from: https://wenku.baidu.com/view/93d8e304dc88d0d233d4b14e852458fb770b3892.html?r e = view.
    [37] Avgoustaki DD, Xydis G (2020) Indoor vertical farming in the urban nexus context: Business growth and resource savings. Sustainability 12: 1965. https://doi.org/10.3390/su12051965 doi: 10.3390/su12051965
    [38] Yang SQ, Jiang F (2021) "Plant Factory" enters the stage of "mass production". Available from: https://new.qq.com/omn/20201017/20201017A02E6H00.html (In Chinese).
    [39] Xi L, Zhang M, Zhang L, et al. (2022) Novel materials for urban farming. Adv Mater 34: 2105009. https://doi.org/10.1002/adma.202105009 doi: 10.1002/adma.202105009
    [40] Gupta GS (2019) Land degradation and challenges of food security. Rev Eur Stud 11: 63. https://doi.org/10.5539/res.v11n1p63 doi: 10.5539/res.v11n1p63
    [41] Jin S, Zhang B, Wu B, et al. (2021) Decoupling livestock and crop production at the household level in China. Nat Sustainability 4: 48–55. https://doi.org/10.1038/s41893-020-00596-0 doi: 10.1038/s41893-020-00596-0
    [42] Wang Y, Wang Y, Su X, et al. (2019) Evaluation of the comprehensive carrying capacity of interprovincial water resources in China and the spatial effect. J Hydrol 575: 794–809. https://doi.org/10.1016/j.jhydrol.2019.05.076 doi: 10.1016/j.jhydrol.2019.05.076
    [43] Mckinsey (2016) The Modernization of the Chinese Consumer. Available from: https://www.mckinsey.com.cn/wp-content/uploads/2016/03/The-Modernization-of-the-Chinese-Consumer_CN.pdf.
    [44] Gupta MK, Ganapuram S (2019) Vertical farming using information and communication technologies. Available from: https://www.infosys.com/.
    [45] Thepaper.cn (2019) Baidu and BOE reached a cooperation to launch intelligent soilless planting of AI plant factory. Available from: https://m.thepaper.cn/baijiahao_4058548?sdkver = e06426d6 & clientprefetch = 1.
    [46] AlescaLife (2020) The scale of vertical agricultural market is within 5 years or more than 10 billion US dollars, and technology and cost are the biggest challenges, SoHu. Available from: https://www.sohu.com/a/415695443_120167070.
    [47] Alescalife (2021) ALESCA Life—Our tool, Alescalife. Available from: https://www.alescalife.com/our-tools/.
    [48] SANANBIO announces the availability of its unmanned vertical farming system (2020) Available from: https://markets.businessinsider.com/news/stocks/sananbio-announces-the-availability-of-its-unmanned-vertical-farming-system-uplift-to-global-growers-1029401929.
    [49] UPLIFT to Global Growers, Prnewswire.com (2022) Available from: https://www.prnewswire.com/ae/news-releases/sananbio-announces-the-availability-of-its- unmanned-vertical-farming-system-uplift-to-global-growers-863228098.html.
    [50] Sananbio US (2014) Vertical Farming Technology. Available from: https://www.sananbious.com/vertical-farming.
    [51] Jiangmen Daily (2015) Guangmingyuan received government subsidies to develop "plant factory"—enterprise dynamics-Aladdin-online Guangya exhibition. Available from: https://www.alighting.com/news_show.aspx?id = 134649.
    [52] Perambalam L, Avgoustaki DD, Efthimiadou A, et al. (2021) How young consumers perceive vertical farming in the nordics. Is the market ready for the coming boom?. Agronomy 11: 2128. https://doi.org/10.3390/agronomy11112128 doi: 10.3390/agronomy11112128
    [53] Avgoustaki DD, Avgoustakis I, Miralles CC, et al. (2022) Autonomous mobile robot with attached multispectral camera to monitor the development of crops and detect nutrient and water deficiencies in vertical farms. Agronomy 12: 2691. https://doi.org/10.3390/agronomy12112691 doi: 10.3390/agronomy12112691
    [54] Wang Y (2017) Plant factory, why is everything ready but wait to explode?. Available from: https://zhuanlan.zhihu.com/p/27294248 (In Chinese).
    [55] Guo X, Xue X, Lu J, et al. (2020) Research and prospect of intelligent equipment for plant factory. Journal of Chinese Agricultural Mechanization 41: 162–169. https://doi.org/10.13733/j.jcam.issn.2095-5553.2020.09.026 doi: 10.13733/j.jcam.issn.2095-5553.2020.09.026
    [56] Xydis GA, Efthimiadou A, Ucal M (2022) Food to grid: Developing a multi-value renewable energy investment ecosystem. Energy Conversion Manag 266: 115850. https://doi.org/10.1016/j.enconman.2022.115850 doi: 10.1016/j.enconman.2022.115850
    [57] Coyle BD, Ellison B (2017) Will consumers find vertically farmed produce "out of reach"?. Choices 32: 1–8.
  • This article has been cited by:

    1. Xue-min Chen, Xin-miao Xue, Ning Yu, Wei-wei Guo, Shuo-long Yuan, Qing-qing Jiang, Shi-ming Yang, The Role of Genetic Variants in the Susceptibility of Noise-Induced Hearing Loss, 2022, 16, 1662-5102, 10.3389/fncel.2022.946206
    2. Athena Rafieepour, Somayeh Farhang Dehgahn, Mahtab Firoozi, Rahim Gorji, Arash Ardalan, Mohammad Hossein Vaziri, Study Highlights Impact of Smoking on Hearing Loss Among Workers Exposed to Noise, 2022, 75, 0745-7472, 24,25,26, 10.1097/01.HJ.0000874576.86751.53
    3. Fang Ji, Jian Zhang, Xiaowen Ding, Li Rong, Xiaodong Liu, Tenglong Yan, Jue Li, Associations of GST Gene Polymorphisms and GST Enzyme Activity with the Development of Noise-Induced Hearing Loss in Chinese Han Males, 2024, 27, 1662-4246, 168, 10.1159/000541618
    4. Svyatoslav I. Mazilov, Nataliia E. Komleva, Tamara A. Novikova, Single nucleotide gene polymorphisms (SNPs) as markers of the increased risk of health disorders associated with exposure to industrial noise, 2023, 63, 2618-8945, 723, 10.31089/1026-9428-2023-63-11-723-729
    5. Margaryta Amirkhanova, Julia Dieieva, THE EFFECT OF POLYMORPHISMS IN THE BCL2, BID AND BAX GENES ON THE DEVELOPMENT OF SENSORINEURAL HEARING LOSS, 2023, 25288253, 29, 10.37219/2528-8253-2023-3-29
  • Reader Comments
  • © 2023 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Metrics

Article views(8845) PDF downloads(283) Cited by(2)

Figures and Tables

Figures(2)

Other Articles By Authors

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog